Biologie /

Transkription

Transkription

 Promoter
3'
51
5'
RANSKRIPTION
Freie mRNA- C
Nukleotide
U
RNA Polymerase
Codogener Strang
CTGACGGAT CAGCCGCAAGCGGAATTAA
GACUGCCUAGU C G G C

Transkription

user profile picture

stella 🧸

26 Followers

Teilen

Speichern

56

 

12

Lernzettel

Definition und Zusammenfassung der Transkription! :)

Nichts passendes dabei? Erkunde andere Fachbereiche.

Promoter 3' 51 5' RANSKRIPTION Freie mRNA- C Nukleotide U RNA Polymerase Codogener Strang CTGACGGAT CAGCCGCAAGCGGAATTAA GACUGCCUAGU C G G C GUU mRNA 3' GACUGCCUAGUCG G C GUUCG CRUVAAUVAA Freie mRNA 5' Terminator XA GAGTGCCTAGTCGGCGTTCGCCTTA ATT 3' ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬ DEFINITION: Die Transkription ist der erste Schritt der Proteinbiosynthese. Bei diesem Schritt wird ein kurzer Abschnitt der DNA einer Zelle in eine mRNA umgeschrieben. Die erstellte mRNA wird dann bei der Translation mithilfe von Ribosomen in Proteine übersetzt. INITIATION: Die RNA-Polymerase setzt sich an die DNA. Sobald sie den sogenannten Promotor erreicht, startet die Transkription. Die RNA-Polymerase entspiralisiert die DNA und löst die Wasserstoffbrückenbindungen zwischen den Basenpaaren. Es entstehen zwei Stränge: der codogene Strang und der nicht-codogene Strang. Der codogene Strang läuft vom 3* – Ende zum 5°- Ende, während der andere Strang antiparallel verläuft (5¹– Ende zum 3-Ende). Der codogene Strang ist für die Transkription der wichtige Strang. ELONGATION Bei der Elongation wird die DNA-Sequenz in die mRNA übertragen. Die CRNA-Polymerase setzt sich an den Promotor und bewegt sich entlang des codogenen Einzelstranges vom 3'Ende zum 5'Ende. Währenddessen liest sie jede Base ab und setzt die zugehörigen, komplementären Nukleotide als neuen Strang an. Der Strang, der sich bildet, ist die mRNA. Dieser läuft in 5'-3' Richtung. Unterschied: die RNA hat keinen Zucker, sondern die Ribose. Und anstatt Thymin Uracil. TERMINATION Hier wird die Transkription endgültig beendet. Sobald die RNA- Polymerase den Terminator erreicht, löst sich die abgeschriebene mRNA sowie die RNA-Polymerase von der...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

DNA. Die DNA fügt ihre Stränge wieder zusammen.

Biologie /

Transkription

user profile picture

stella 🧸   

Follow

26 Followers

 Promoter
3'
51
5'
RANSKRIPTION
Freie mRNA- C
Nukleotide
U
RNA Polymerase
Codogener Strang
CTGACGGAT CAGCCGCAAGCGGAATTAA
GACUGCCUAGU C G G C

App öffnen

Definition und Zusammenfassung der Transkription! :)

Ähnliche Knows

user profile picture

Transkription

Know Transkription  thumbnail

5

 

11/12

user profile picture

Die Proteinbiosynthese/Eiweißsynthese

Know Die Proteinbiosynthese/Eiweißsynthese thumbnail

16

 

11/12/13

N

2

Transkription

Know Transkription  thumbnail

1

 

11/12/13

user profile picture

7

Lernzettel Biologie Genetik

Know Lernzettel Biologie Genetik  thumbnail

18

 

11/12/13

Promoter 3' 51 5' RANSKRIPTION Freie mRNA- C Nukleotide U RNA Polymerase Codogener Strang CTGACGGAT CAGCCGCAAGCGGAATTAA GACUGCCUAGU C G G C GUU mRNA 3' GACUGCCUAGUCG G C GUUCG CRUVAAUVAA Freie mRNA 5' Terminator XA GAGTGCCTAGTCGGCGTTCGCCTTA ATT 3' ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬ DEFINITION: Die Transkription ist der erste Schritt der Proteinbiosynthese. Bei diesem Schritt wird ein kurzer Abschnitt der DNA einer Zelle in eine mRNA umgeschrieben. Die erstellte mRNA wird dann bei der Translation mithilfe von Ribosomen in Proteine übersetzt. INITIATION: Die RNA-Polymerase setzt sich an die DNA. Sobald sie den sogenannten Promotor erreicht, startet die Transkription. Die RNA-Polymerase entspiralisiert die DNA und löst die Wasserstoffbrückenbindungen zwischen den Basenpaaren. Es entstehen zwei Stränge: der codogene Strang und der nicht-codogene Strang. Der codogene Strang läuft vom 3* – Ende zum 5°- Ende, während der andere Strang antiparallel verläuft (5¹– Ende zum 3-Ende). Der codogene Strang ist für die Transkription der wichtige Strang. ELONGATION Bei der Elongation wird die DNA-Sequenz in die mRNA übertragen. Die CRNA-Polymerase setzt sich an den Promotor und bewegt sich entlang des codogenen Einzelstranges vom 3'Ende zum 5'Ende. Währenddessen liest sie jede Base ab und setzt die zugehörigen, komplementären Nukleotide als neuen Strang an. Der Strang, der sich bildet, ist die mRNA. Dieser läuft in 5'-3' Richtung. Unterschied: die RNA hat keinen Zucker, sondern die Ribose. Und anstatt Thymin Uracil. TERMINATION Hier wird die Transkription endgültig beendet. Sobald die RNA- Polymerase den Terminator erreicht, löst sich die abgeschriebene mRNA sowie die RNA-Polymerase von der...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich einfach.

App öffnen

Alternativer Bildtext:

DNA. Die DNA fügt ihre Stränge wieder zusammen.