Natura Buch Gymnasium LÖSUNGEN

user profile picture

Emily

146 Followers
 

Biologie

 

11/12/10

Vorlage

Natura Buch Gymnasium LÖSUNGEN

 NATURA
Biologie für Gymnasien
bearbeitet von
Irmtraud Beyer
Horst Bickel
Harald Gropengießer
Siegfried Kluge
Bernhard Knauer
Inge Kronberg

Kommentare (2)

Teilen

Speichern

154

•Biologie •Alle Lösungen zu dem Bio Buch: Natura Biologie für Gymnasien

Nichts passendes dabei? Erkunde andere Fachbereiche.

NATURA Biologie für Gymnasien bearbeitet von Irmtraud Beyer Horst Bickel Harald Gropengießer Siegfried Kluge Bernhard Knauer Inge Kronberg Hans-Peter Krull Hans-Dieter Lichtner Horst Schneeweiß Gerhard Ströhla Wolfgang Tischer Nordrhein-Westfalen Oberstufe G8 Lösungen Ernst Klett Verlag Stuttgart Leipzig 1. Auflage, 2011 Alle Drucke dieser Auflage sind unverändert und können im Unterricht nebeneinander verwendet werden. Die letzte Zahl bezeichnet das Jahr des Druckes. Das Werk und seine Teile sind urheberrechtlich geschützt. Jede Nutzung in anderen als den gesetzlich zugelassenen Fällen bedarf der vorherigen schriftlichen Einwilligung des Verlages. Hinweis §52 a UrhG: Weder das Werk noch seine Teile dürfen ohne eine solche Einwilligung eingescannt und in ein Netzwerk eingestellt werden. Dies gilt auch für Intranets von Schulen und sonstigen Bildungseinrichtungen. Fotomechanische oder andere Wiedergabeverfahren nur mit Genehmigung des Verlages. © Ernst Klett Verlag GmbH, Stuttgart 2011. Alle Rechte vorbehalten. www.klett.de Autoren: Dr. Irmtraud Beyer: Ricarda-Huch-Schule, Gymnasium, Dreieich; Dr. Horst Bickel; Geschwister Scholl Gymnasium, Düsseldorf; Studienseminar für das Lehramt an Gymnasien und Gesamtschule, Düsseldorf; Prof. Dr. Harald Gropengießer; Universität Hannover, Fachbereich Erziehungswissenschaften; Prof. Dr. Siegfried Kluge; Neumark; Bernhard Knauer; Hainberg- Gymnasium, Göttingen; Dr. Inge Kronberg; Fachautorin und Dozentin, Hohenwestedt; Hans-Peter Krull; Albert-Einstein-Gymnasium, Kaarst; Hans-Dieter Lichtner; Rats-Gymnasium, Stadthagen; Dr. Horst Schneeweiß; Gymnasium Othmarschen, Hamburg; Gerhard Ströhla; Gmnasium Münchberg; Dr. Wolfgang Tischer; Gymnasium Saarstedt Redaktion: Rolf Strecker Mediengestaltung: Ingrid Walter Gestaltung: Prof. Jürgen Wirth; Visuelle Kommunikation, Dreieich unter Mitarbeit von Matthias Balonier, Evelyn Junqueira, Nora Wirth Illustrationen: Jörg Mair, München Printed in Germany A15150-04546001 Genetik 1 DNA - Träger...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

der Erbinformation Träger der Erbinformation – experimentelle Beweise (Seite 10) 1 OSWALD AVERY führte eine Reihe von Kontrollexperimenten durch. Beispielsweise behandelte er die abgetrennte DNA zusätz- lich mit Protein spaltenden Enzymen (Proteasen) und die Proteine mit DNA spaltenden Enzymen (DNAsen). Begründen Sie. AVERY wollte sicher gehen, dass in den DNA-Präparationen keine Proteine und in den Proteinpräparationen keine DNA-Mole- küle mehr enthalten sind. 2 AVERY gab seinen Bakterienkulturen Serum zu. Hitzebehandeltes Serum beeinträchtigte seine Versuche nicht. Unbehandeltes Serum hingegen verhinderte oftmals eine Transformation von R-Zellen durch isoliertes Material aus S-Zellen. Serum enthält ei- ne Reihe verschiedener Enzyme. Erklären Sie. Serum enthält eine Reihe von Enzymen, darunter auch DNAsen. Die Hitzebehandlung denaturiert diese Enzyme, die DNA in den Extrakten wird dann nicht mehr abgebaut. Im nicht behandelten Serum sind die DNAsen aktiv und zerstören die DNA- Moleküle, eine Transformation bleibt dann natürlich aus. Praktikum: Experimente mit DNA (Seite 11) Entwickeln Sie ein Experiment, mit dem der folgende Einwand entkräftet werden kann: „Bei der Behandlung der isolierten DNA mit Säure ist keine Hydrolyse aufgetreten, vielmehr ist die DNA wieder in eine lösliche Form übergegangen." Die Säure durch Zugabe einer Base neutralisieren und dann den DNA-Fällungsversuch erneut durchführen. 2 Im DNA-Fällungsversuch wird Feinwaschmittel, das Proteasen enthält, zugesetzt. Proteasen sind Protein spaltende Enzyme. Mit welchen Proteinen ist das DNA-Molekül assoziiert? Schlagen Sie in diesem Buch nach. DNA ist in der Hauptsache mit Histonproteinen assoziiert. 3 Erläutern Sie, welche Ladungen und Größe die aufgetrennten DNA-Fragmente haben. Da die Fragmente im elektrischen Gleichspannungsfeld von - nach + wandern, sind sie negativ geladen. Das größere Bruch- stück, das nicht so weit im Gel (Spur 2) gewandert ist, hat eine Größe von 200 Basenpaaren (BP), das kleinere, weiter gewan- derte eine Größe von 100 (BP). 4 Erklären Sie, wie oft das verwendete Restriktionsenzym die Proben-DNA (Spur 1) in Spur 2 geschnitten hat. Das Enzym hat einmal geschnitten. Da es sich bei der Probe um fädige, also lineare DNA handelt, resultieren bei einem Schnitt zwei Bruchstücke. DNA-Replikation aus eins mach zwei (Seite 15) Inwieweit lässt sich das Schema der Replikation aus dem Bau der DNA ableiten? Der Strickleiterbau der DNA-Doppelhelix mit Sprossen aus komplementären Basenpaaren lässt eine semikonservative Ver- dopplung der DNA zu: Werden die Wasserstoffbrückenbindungen zwischen den komplementären Basen gelöst, liegen Einzel- stränge vor, an die Basen bzw. Nucleotide spezifisch binden können. Die Basensequenz des elterlichen Einzelstranges legt damit die Basensequenz des Tochterstranges eindeutig fest. Material: DNA-Verdopplung - wie und wann? (Seite 16) DNA wird nach dem semikonservativen Mechanismus repliziert. Begründen Sie anhand von Abb. 2. Nach einer ersten Replikation liegt im Versuch nur halbschwere DNA vor. Halbschwere DNA kann nach einem ersten Replikati- onszyklus nur bei einer semikonservativen oder einer dispersiven Replikation entstehen. Der konservative Mechanismus steht damit im Gegensatz zu den experimentellen Ergebnissen und scheidet aufgrund dieser Überlegungen aus. Nach zwei Replika- tionszyklen liegt zur Hälfte halbschwere und zur Hälfte leichte DNA vor. Mit diesem Ergebnis ist auch die dispersive Replikation ausgeschlossen. 2 Welche Dichteverteilung hätten Sie bei konservativer, welche bei disperser Verdopplung erwartet? Bei einem konservativen Replikationsmechanismus läge nach der ersten Replikation der schweren Ausgangs-DNA ein schwe- rer und ein neu synthetisierter, leichter DNA-Doppelstrang vor. Nach einem zweiten Replikationszyklus bliebe wiederum der schwere Doppelstrang erhalten. Zu ihm würde wie zu dem zweiten leichten ein leichter synthetisiert, sodass am Ende ein schwerer und drei leichte Doppelstränge resultieren würden. Bei einem dispersen Replikationsmechanismus würde ursprüngliche schwere und neue leichte DNA statistisch auf die entste- henden Doppelstränge verteilt. Es entstünden nach dem ersten Replikationszyklus zwei Doppelstränge, die im Mittel zu glei- chen Teilen schwere und leichte DNA enthielten. Sie wären also halbschwer. Nach einem zweiten Replikationszyklus würde sich die schwere DNA wiederum statistisch verteilen, die Doppelstränge wären also „viertelschwer". Die Abb. zeigt die Autoradiographie von Leberzellen. Wie hoch ist der Prozentsatz replizierender Zellen? 14 Zellen zeigen eine Schwärzung, 5 keine Schwärzung. Der Prozentsatz replizierender Zellen beträgt demnach ca. 74%. 3 Genexpression: von der Information zum Produkt (Seite 19) Ⓒ Stellen Sie in einer Tabelle DNA-Replikation und Transkription gegenüber, indem Sie Funktion, Zeitpunkt im Zellzyklus, Enzyme und Nucleotide auflisten. siehe Tabelle DNA-Replikation identische Verdopplung der DNA (zwischen zwei Zellteilungen) in der Interphase ermöglicht die Weitergabe der Gene an beide Tochterzellen Enzym DNA-Polysom DNA-Nucleotide (Basen G, C, A, T) Die m-RNA lautet: 5'GACCGAUGACUGGGCGAAGAAGAUAG3¹ Die Aminosäuresequenz lautet: Met-Thr-Gly-Arg-Arg-Arg-Stopp Der genetische Code (Seite 20) Suchen Sie das Startcodon und translatieren Sie diese m-RNA-Sequenz: 5'UUAGAUGAGCGACGAACCCCUAAAAUUUACCUAGUAGUAGCCAU3¹ Start- und Stopp-Codon sind: Met-Ser-Asp-Glu-Pro-Leu-Lys-Phe-Thr-Stopp-Stopp-Stopp 2 In welche Aminosäuresequenz wird folgender Abschnitt eines codogenen Strangs der DNA übersetzt? 3'CTGGCTTGAACCCGCTTCTTCTATC5¹ t-RNA-Moleküle 3 Lassen Sie den ersten Buchstaben im Beispielsatz „VORDERRNAISTDIEDNA" weg und behalten den „Triplettcode" bei, wird der Sinn des Satzes entstellt. Erläutern Sie, welche Konsequenz es hätte, wenn in der oben gezeigten DNA-Sequenz die erste Base wegfallen würde. Die m-RNA lautet: 5'ACCGAUGACUGGGCGAAGAAGAUAG3¹ Durch die Verschiebung des Leserasters entfällt das Start-Codon AUG, es gibt kein Genprodukt. unmarkierte Aminosäuren, alle außer Serin O radioaktiv markiertes Serin Material: Die Entdeckung des genetischen Codes (Seite 21) Skizzieren Sie den Versuchsaufbau von NIRENBERG und LEDERER, mit dem der genetische Code entschlüsselt wurde. s. Skizze Tripletts AGU P UCU Transkription ACU ACU ACU ACU Bildung eines m-RNA-Gegenstückes in der Interphase (Arbeits- phase) des Kerns Teil der phänotypischen Umsetzung der genetischen Information Enzym RNA-Polymerase RNA-Nucleotide (Basen G, C, A, U) UCU mischen Ribosomen Immobilisieren der Ribosomen auf einem Filter nur die Serin-RNA bindet an das Ribosom und das Triplett ungebundene t-RNA- Moleküle passieren das Filter 2 Ziehen Sie Schlüsse aufgrund der experimentellen Befunde zur Bedeutung der Tripletts UUU und UCU. UUU codiert für die Aminosäure Phenylalanin (Phe). ist das Filter radioaktiv? wenn ja, codiert UCU für Serin 3 Aus den Ribosomenpräparationen wurden vor den Triplettbindungstests alle m-RNA-Moleküle der Herkunftszellen entfernt. Warum? Die radioaktiv markierten Aminosäuren wären ansonsten bei der Translation der m-RNAs der Herkunftszelle in die Proteine eingebaut worden, die Radioaktivität hätte sich auf dem Filter wiedergefunden, die Bedeutung der kurzen m-RNAs bekannter Sequenz hätte sich nicht aufklären lassen. 4 Verwendet man Poly-U, Poly-A, Poly-C bzw. Poly-G, erhält man die unten aufgeführten Peptide mit jeweils nur einer Aminosäu- reart. Damit ist die Bedeutung von 4 Tripletts geklärt. Geben Sie diese an. In der künstlichen m-RNA folgen immer die gleichen Tripletts aufeinander und werden natürlich in ein Protein aus immer glei- chen Aminosäuren übersetzt. Die vier Tripletts und ihre Bedeutung sind: UUU = Phenylalanin, AAA = Lysin, CCC = Prolin, GGG = Glycin 4 5 Verwendet man RNA, in der zwei Nucleotide abwechselnd vorkommen, erhält man Peptide, in denen sich zwei Aminosäuren abwechseln. Erklären Sie, ob man durch diese Versuche die Bedeutung weiterer Tripletts eindeutig klären kann und begründen Sie Ihre Aussage. Es ist nicht klar, an welcher Stelle die Translation beginnt. Ist A der Translationsstart, ergibt sich die Triplett-Reihenfolge ACA- CAC-ACA-CAC-... Das Peptid hätte die Aminosäuresequenz: Thr-His-Thr-His-... Ist C der Translationsstart, ergibt sich die Triplett-Reihenfolge CAC-ACA-CAC-ACA-... Das Peptid hätte die Aminosäuresequenz His-Thr-His-Thr. 6 Verwendet man andere, regelmäßige Polynucleotide aus längeren Untereinheiten, erhält man im Gemisch verschiedene Peptide (s. unten). Warum werden dann jeweils mehrere verschiedene Peptide aufgebaut? Klären Sie mithilfe der Angaben zu Aufgabe 4 und 5 die Bedeutung weiterer Nucleotide auf. Auch hier ist wieder nicht festgelegt, wo die Translation beginnt, es sind mehrere Triplettraster möglich: AAC-AAC-AAC-AAC-... = Poly Asn = Poly Thr ACA-ACA-ACA-ACA-... CAA-CAA-CAA-CAA-... = Poly Gln Auf die Bedeutung der Tripletts kann erst im Vergleich mit anderen Versuchsergebnissen geschlossen werden. Beispielsweise tritt sowohl in Poly-AC als auch in Poly-AAC das Triplett ACA auf. In beiden erzeugten Peptiden findet sich folglich die von ACA codierte Aminosäure Thr. Damit ist aber auch klar, dass das zweite in Poly-AC mögliche Triplett CAC für die Aminosäure Histi- din codieren muss. Ⓒ Auch RNA-Moleküle mit 4 regelmäßig wechselnden Nucleotiden wurden konstruiert. Welche Tripletts lassen sich mithilfe des Produktes (s. Tabelle) klären? Warum tritt eine Wiederholung in der Primärstruktur nach 4 Aminosäuren auf? Mit Poly-ACCC ergibt sich ein Peptid mit dem sich wiederholenden Sequenzmotiv Thr-His-Pro-Pro-Thr-His-Pro-Pro- ... unab- hängig vom Startpunkt. Die vier möglichen Starttripletts (ACC, CCC, CCA, CAC) legen lediglich fest, an welcher Aminosäure- position der „Einstieg" in das Sequenzmotiv genommen wird. Dass das Triplett CCC für Pro codiert, zeigt Aufgabe 4. Nach Pro im entweder Pro oder Thr. Da ACC immer auf das Triplett CCC folgt, mus es für Thr codieren, CCA ebenfalls für Pro. Dass CAC für His codiert, geht aus Aufgabe 4 hervor, ACC bleibt übrig, es codiert folglich für die übrig bleibende Amino- säure Thr. Codon-Bevorzugung (Zettelkasten Seite 22) 1 Die Codon-Bevorzugung spiegelt sich in der Konzentration der t-RNA-Moleküle wider. Welches Problem kann auftreten, wenn man ein Gen, beispielsweise von Escherichia coli, auf Saccharomyces frugiperda über- trägt, um das zugehörige Protein herstellen zu lassen? Die Biosynthese des Proteins aus E. coli kann ineffektiv sein, wenn in S. frugiperda das Codon CCG sehr viel seltener verwen- det wird, da die Konzentration der entsprechenden t-RNA dann ebenfalls sehr niedrig ist. Translation: Ein Protein entsteht (Seite 23) RNA und Proteine gehören unterschiedlichen chemischen Stoffklassen an. Dennoch gibt es strukturelle und funktionelle Paral- lelen. Begründen Sie. t-RNA-Moleküle sind wie Proteine dreidimensionale Gebilde. Erst ihre Raumstruktur ermöglicht es ihnen, ihre Funktion auszu- führen. Beispielsweise erkennen t-RNA-Moleküle die passenden Aminoaceyl-t-RNA-Synthetasen aufgrund ihrer räumlichen Passung nach dem Schlüssel-Schloss-Prinzip. 2 Das Codon AUG hat zwei verschiedene Bedeutungen, je nachdem ob es sich am Anfang einer m-RNA oder nicht befindet. Begründen Sie. Als Startcodon markiert AUG auf einer m-RNA den Beginn der Translation, fungiert also als „Satzzeichen“. Methionin ist dem- gemäß die erste Aminosäure eines Proteins, die aber meist bei der Reifung von Proteinen wieder abgespalten wird. Innerhalb eines Proteins codiert das Codon AUG lediglich für die Aminosäure Methionin und hat darüber hinaus keine weitere Bedeutung. 3 Formulieren Sie zu dem codogenen DNA-Abschnitt unten die komplementäre m-RNA. Formulieren Sie dann die komplementä- ren Anticodons und die zugehörigen Aminosäuren: 3'CTGGCTTGAACCCGCTTC5¹ Die Sequenz der m-RNA lautet: 5'GACCGAACUUGGGCGAAG3¹ Die Sequenzen der Anticodons lauten: 3'CUG-GCU-UGA-ACC-CGC-UUC5* Die Aminosäuresequenz lautet: Aps-Arg-Thr-Trp-Ala-Lys Proteinbiosynthese bei Eukaryoten (Seite 25) Menschliches Insulin kann von „umprogrammierten" Bakterienzellen erzeugt werden. Man überträgt dazu die für Inuslin codie- rende Nucleinsäure. Mit welchen Schwierigkeiten ist aufgrund der unterschiedlichen Proteinbiosynthese von Pro- und Eukaryo- ten zu rechnen? Eukaryotische Gene sind gestückelt, prokaryotische hingegen nicht. Das heißt, würde das Insulin-Gen auf Bakterien übertra- gen, könnten die Introns nicht entfernt werden, da Prokaryoten die entsprechenden Spleiß-Enzyme nicht besitzen. Die Protein- biosynthese des Insulins gelänge nicht. Um dieses Problem zu umgehen, schreibt man die Insulin-m-RNA, die aufgrund des Spleißens keine Introns mehr aufweist, mithilfe des Enzyms Reverse Transkriptase in c-DNA und überträgt sie auf Bakterien. 5

Natura Buch Gymnasium LÖSUNGEN

user profile picture

Emily

146 Followers
 

Biologie

 

11/12/10

Vorlage

Natura Buch Gymnasium LÖSUNGEN

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 NATURA
Biologie für Gymnasien
bearbeitet von
Irmtraud Beyer
Horst Bickel
Harald Gropengießer
Siegfried Kluge
Bernhard Knauer
Inge Kronberg

App öffnen

Teilen

Speichern

154

Kommentare (2)

W

So ein schöner Lernzettel 😍😍 super nützlich und hilfreich!

•Biologie •Alle Lösungen zu dem Bio Buch: Natura Biologie für Gymnasien

Ähnliche Knows

13

Genetik: Proteinbiosynthese, Genetischer Code, Mutationen, Genregulation

Know Genetik: Proteinbiosynthese, Genetischer Code, Mutationen, Genregulation thumbnail

293

 

11/12/13

8

Proteinbiosynthese (Translation, Transkription), Genmutation

Know Proteinbiosynthese (Translation, Transkription), Genmutation thumbnail

1902

 

11/12/13

170

Natura Biobuch Lösungen

Know Natura Biobuch Lösungen thumbnail

936

 

11/12/13

Proteinbiosynthese und genetischer Code

Know Proteinbiosynthese und genetischer Code thumbnail

9244

 

11/12/10

Mehr

NATURA Biologie für Gymnasien bearbeitet von Irmtraud Beyer Horst Bickel Harald Gropengießer Siegfried Kluge Bernhard Knauer Inge Kronberg Hans-Peter Krull Hans-Dieter Lichtner Horst Schneeweiß Gerhard Ströhla Wolfgang Tischer Nordrhein-Westfalen Oberstufe G8 Lösungen Ernst Klett Verlag Stuttgart Leipzig 1. Auflage, 2011 Alle Drucke dieser Auflage sind unverändert und können im Unterricht nebeneinander verwendet werden. Die letzte Zahl bezeichnet das Jahr des Druckes. Das Werk und seine Teile sind urheberrechtlich geschützt. Jede Nutzung in anderen als den gesetzlich zugelassenen Fällen bedarf der vorherigen schriftlichen Einwilligung des Verlages. Hinweis §52 a UrhG: Weder das Werk noch seine Teile dürfen ohne eine solche Einwilligung eingescannt und in ein Netzwerk eingestellt werden. Dies gilt auch für Intranets von Schulen und sonstigen Bildungseinrichtungen. Fotomechanische oder andere Wiedergabeverfahren nur mit Genehmigung des Verlages. © Ernst Klett Verlag GmbH, Stuttgart 2011. Alle Rechte vorbehalten. www.klett.de Autoren: Dr. Irmtraud Beyer: Ricarda-Huch-Schule, Gymnasium, Dreieich; Dr. Horst Bickel; Geschwister Scholl Gymnasium, Düsseldorf; Studienseminar für das Lehramt an Gymnasien und Gesamtschule, Düsseldorf; Prof. Dr. Harald Gropengießer; Universität Hannover, Fachbereich Erziehungswissenschaften; Prof. Dr. Siegfried Kluge; Neumark; Bernhard Knauer; Hainberg- Gymnasium, Göttingen; Dr. Inge Kronberg; Fachautorin und Dozentin, Hohenwestedt; Hans-Peter Krull; Albert-Einstein-Gymnasium, Kaarst; Hans-Dieter Lichtner; Rats-Gymnasium, Stadthagen; Dr. Horst Schneeweiß; Gymnasium Othmarschen, Hamburg; Gerhard Ströhla; Gmnasium Münchberg; Dr. Wolfgang Tischer; Gymnasium Saarstedt Redaktion: Rolf Strecker Mediengestaltung: Ingrid Walter Gestaltung: Prof. Jürgen Wirth; Visuelle Kommunikation, Dreieich unter Mitarbeit von Matthias Balonier, Evelyn Junqueira, Nora Wirth Illustrationen: Jörg Mair, München Printed in Germany A15150-04546001 Genetik 1 DNA - Träger...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen

Alternativer Bildtext:

der Erbinformation Träger der Erbinformation – experimentelle Beweise (Seite 10) 1 OSWALD AVERY führte eine Reihe von Kontrollexperimenten durch. Beispielsweise behandelte er die abgetrennte DNA zusätz- lich mit Protein spaltenden Enzymen (Proteasen) und die Proteine mit DNA spaltenden Enzymen (DNAsen). Begründen Sie. AVERY wollte sicher gehen, dass in den DNA-Präparationen keine Proteine und in den Proteinpräparationen keine DNA-Mole- küle mehr enthalten sind. 2 AVERY gab seinen Bakterienkulturen Serum zu. Hitzebehandeltes Serum beeinträchtigte seine Versuche nicht. Unbehandeltes Serum hingegen verhinderte oftmals eine Transformation von R-Zellen durch isoliertes Material aus S-Zellen. Serum enthält ei- ne Reihe verschiedener Enzyme. Erklären Sie. Serum enthält eine Reihe von Enzymen, darunter auch DNAsen. Die Hitzebehandlung denaturiert diese Enzyme, die DNA in den Extrakten wird dann nicht mehr abgebaut. Im nicht behandelten Serum sind die DNAsen aktiv und zerstören die DNA- Moleküle, eine Transformation bleibt dann natürlich aus. Praktikum: Experimente mit DNA (Seite 11) Entwickeln Sie ein Experiment, mit dem der folgende Einwand entkräftet werden kann: „Bei der Behandlung der isolierten DNA mit Säure ist keine Hydrolyse aufgetreten, vielmehr ist die DNA wieder in eine lösliche Form übergegangen." Die Säure durch Zugabe einer Base neutralisieren und dann den DNA-Fällungsversuch erneut durchführen. 2 Im DNA-Fällungsversuch wird Feinwaschmittel, das Proteasen enthält, zugesetzt. Proteasen sind Protein spaltende Enzyme. Mit welchen Proteinen ist das DNA-Molekül assoziiert? Schlagen Sie in diesem Buch nach. DNA ist in der Hauptsache mit Histonproteinen assoziiert. 3 Erläutern Sie, welche Ladungen und Größe die aufgetrennten DNA-Fragmente haben. Da die Fragmente im elektrischen Gleichspannungsfeld von - nach + wandern, sind sie negativ geladen. Das größere Bruch- stück, das nicht so weit im Gel (Spur 2) gewandert ist, hat eine Größe von 200 Basenpaaren (BP), das kleinere, weiter gewan- derte eine Größe von 100 (BP). 4 Erklären Sie, wie oft das verwendete Restriktionsenzym die Proben-DNA (Spur 1) in Spur 2 geschnitten hat. Das Enzym hat einmal geschnitten. Da es sich bei der Probe um fädige, also lineare DNA handelt, resultieren bei einem Schnitt zwei Bruchstücke. DNA-Replikation aus eins mach zwei (Seite 15) Inwieweit lässt sich das Schema der Replikation aus dem Bau der DNA ableiten? Der Strickleiterbau der DNA-Doppelhelix mit Sprossen aus komplementären Basenpaaren lässt eine semikonservative Ver- dopplung der DNA zu: Werden die Wasserstoffbrückenbindungen zwischen den komplementären Basen gelöst, liegen Einzel- stränge vor, an die Basen bzw. Nucleotide spezifisch binden können. Die Basensequenz des elterlichen Einzelstranges legt damit die Basensequenz des Tochterstranges eindeutig fest. Material: DNA-Verdopplung - wie und wann? (Seite 16) DNA wird nach dem semikonservativen Mechanismus repliziert. Begründen Sie anhand von Abb. 2. Nach einer ersten Replikation liegt im Versuch nur halbschwere DNA vor. Halbschwere DNA kann nach einem ersten Replikati- onszyklus nur bei einer semikonservativen oder einer dispersiven Replikation entstehen. Der konservative Mechanismus steht damit im Gegensatz zu den experimentellen Ergebnissen und scheidet aufgrund dieser Überlegungen aus. Nach zwei Replika- tionszyklen liegt zur Hälfte halbschwere und zur Hälfte leichte DNA vor. Mit diesem Ergebnis ist auch die dispersive Replikation ausgeschlossen. 2 Welche Dichteverteilung hätten Sie bei konservativer, welche bei disperser Verdopplung erwartet? Bei einem konservativen Replikationsmechanismus läge nach der ersten Replikation der schweren Ausgangs-DNA ein schwe- rer und ein neu synthetisierter, leichter DNA-Doppelstrang vor. Nach einem zweiten Replikationszyklus bliebe wiederum der schwere Doppelstrang erhalten. Zu ihm würde wie zu dem zweiten leichten ein leichter synthetisiert, sodass am Ende ein schwerer und drei leichte Doppelstränge resultieren würden. Bei einem dispersen Replikationsmechanismus würde ursprüngliche schwere und neue leichte DNA statistisch auf die entste- henden Doppelstränge verteilt. Es entstünden nach dem ersten Replikationszyklus zwei Doppelstränge, die im Mittel zu glei- chen Teilen schwere und leichte DNA enthielten. Sie wären also halbschwer. Nach einem zweiten Replikationszyklus würde sich die schwere DNA wiederum statistisch verteilen, die Doppelstränge wären also „viertelschwer". Die Abb. zeigt die Autoradiographie von Leberzellen. Wie hoch ist der Prozentsatz replizierender Zellen? 14 Zellen zeigen eine Schwärzung, 5 keine Schwärzung. Der Prozentsatz replizierender Zellen beträgt demnach ca. 74%. 3 Genexpression: von der Information zum Produkt (Seite 19) Ⓒ Stellen Sie in einer Tabelle DNA-Replikation und Transkription gegenüber, indem Sie Funktion, Zeitpunkt im Zellzyklus, Enzyme und Nucleotide auflisten. siehe Tabelle DNA-Replikation identische Verdopplung der DNA (zwischen zwei Zellteilungen) in der Interphase ermöglicht die Weitergabe der Gene an beide Tochterzellen Enzym DNA-Polysom DNA-Nucleotide (Basen G, C, A, T) Die m-RNA lautet: 5'GACCGAUGACUGGGCGAAGAAGAUAG3¹ Die Aminosäuresequenz lautet: Met-Thr-Gly-Arg-Arg-Arg-Stopp Der genetische Code (Seite 20) Suchen Sie das Startcodon und translatieren Sie diese m-RNA-Sequenz: 5'UUAGAUGAGCGACGAACCCCUAAAAUUUACCUAGUAGUAGCCAU3¹ Start- und Stopp-Codon sind: Met-Ser-Asp-Glu-Pro-Leu-Lys-Phe-Thr-Stopp-Stopp-Stopp 2 In welche Aminosäuresequenz wird folgender Abschnitt eines codogenen Strangs der DNA übersetzt? 3'CTGGCTTGAACCCGCTTCTTCTATC5¹ t-RNA-Moleküle 3 Lassen Sie den ersten Buchstaben im Beispielsatz „VORDERRNAISTDIEDNA" weg und behalten den „Triplettcode" bei, wird der Sinn des Satzes entstellt. Erläutern Sie, welche Konsequenz es hätte, wenn in der oben gezeigten DNA-Sequenz die erste Base wegfallen würde. Die m-RNA lautet: 5'ACCGAUGACUGGGCGAAGAAGAUAG3¹ Durch die Verschiebung des Leserasters entfällt das Start-Codon AUG, es gibt kein Genprodukt. unmarkierte Aminosäuren, alle außer Serin O radioaktiv markiertes Serin Material: Die Entdeckung des genetischen Codes (Seite 21) Skizzieren Sie den Versuchsaufbau von NIRENBERG und LEDERER, mit dem der genetische Code entschlüsselt wurde. s. Skizze Tripletts AGU P UCU Transkription ACU ACU ACU ACU Bildung eines m-RNA-Gegenstückes in der Interphase (Arbeits- phase) des Kerns Teil der phänotypischen Umsetzung der genetischen Information Enzym RNA-Polymerase RNA-Nucleotide (Basen G, C, A, U) UCU mischen Ribosomen Immobilisieren der Ribosomen auf einem Filter nur die Serin-RNA bindet an das Ribosom und das Triplett ungebundene t-RNA- Moleküle passieren das Filter 2 Ziehen Sie Schlüsse aufgrund der experimentellen Befunde zur Bedeutung der Tripletts UUU und UCU. UUU codiert für die Aminosäure Phenylalanin (Phe). ist das Filter radioaktiv? wenn ja, codiert UCU für Serin 3 Aus den Ribosomenpräparationen wurden vor den Triplettbindungstests alle m-RNA-Moleküle der Herkunftszellen entfernt. Warum? Die radioaktiv markierten Aminosäuren wären ansonsten bei der Translation der m-RNAs der Herkunftszelle in die Proteine eingebaut worden, die Radioaktivität hätte sich auf dem Filter wiedergefunden, die Bedeutung der kurzen m-RNAs bekannter Sequenz hätte sich nicht aufklären lassen. 4 Verwendet man Poly-U, Poly-A, Poly-C bzw. Poly-G, erhält man die unten aufgeführten Peptide mit jeweils nur einer Aminosäu- reart. Damit ist die Bedeutung von 4 Tripletts geklärt. Geben Sie diese an. In der künstlichen m-RNA folgen immer die gleichen Tripletts aufeinander und werden natürlich in ein Protein aus immer glei- chen Aminosäuren übersetzt. Die vier Tripletts und ihre Bedeutung sind: UUU = Phenylalanin, AAA = Lysin, CCC = Prolin, GGG = Glycin 4 5 Verwendet man RNA, in der zwei Nucleotide abwechselnd vorkommen, erhält man Peptide, in denen sich zwei Aminosäuren abwechseln. Erklären Sie, ob man durch diese Versuche die Bedeutung weiterer Tripletts eindeutig klären kann und begründen Sie Ihre Aussage. Es ist nicht klar, an welcher Stelle die Translation beginnt. Ist A der Translationsstart, ergibt sich die Triplett-Reihenfolge ACA- CAC-ACA-CAC-... Das Peptid hätte die Aminosäuresequenz: Thr-His-Thr-His-... Ist C der Translationsstart, ergibt sich die Triplett-Reihenfolge CAC-ACA-CAC-ACA-... Das Peptid hätte die Aminosäuresequenz His-Thr-His-Thr. 6 Verwendet man andere, regelmäßige Polynucleotide aus längeren Untereinheiten, erhält man im Gemisch verschiedene Peptide (s. unten). Warum werden dann jeweils mehrere verschiedene Peptide aufgebaut? Klären Sie mithilfe der Angaben zu Aufgabe 4 und 5 die Bedeutung weiterer Nucleotide auf. Auch hier ist wieder nicht festgelegt, wo die Translation beginnt, es sind mehrere Triplettraster möglich: AAC-AAC-AAC-AAC-... = Poly Asn = Poly Thr ACA-ACA-ACA-ACA-... CAA-CAA-CAA-CAA-... = Poly Gln Auf die Bedeutung der Tripletts kann erst im Vergleich mit anderen Versuchsergebnissen geschlossen werden. Beispielsweise tritt sowohl in Poly-AC als auch in Poly-AAC das Triplett ACA auf. In beiden erzeugten Peptiden findet sich folglich die von ACA codierte Aminosäure Thr. Damit ist aber auch klar, dass das zweite in Poly-AC mögliche Triplett CAC für die Aminosäure Histi- din codieren muss. Ⓒ Auch RNA-Moleküle mit 4 regelmäßig wechselnden Nucleotiden wurden konstruiert. Welche Tripletts lassen sich mithilfe des Produktes (s. Tabelle) klären? Warum tritt eine Wiederholung in der Primärstruktur nach 4 Aminosäuren auf? Mit Poly-ACCC ergibt sich ein Peptid mit dem sich wiederholenden Sequenzmotiv Thr-His-Pro-Pro-Thr-His-Pro-Pro- ... unab- hängig vom Startpunkt. Die vier möglichen Starttripletts (ACC, CCC, CCA, CAC) legen lediglich fest, an welcher Aminosäure- position der „Einstieg" in das Sequenzmotiv genommen wird. Dass das Triplett CCC für Pro codiert, zeigt Aufgabe 4. Nach Pro im entweder Pro oder Thr. Da ACC immer auf das Triplett CCC folgt, mus es für Thr codieren, CCA ebenfalls für Pro. Dass CAC für His codiert, geht aus Aufgabe 4 hervor, ACC bleibt übrig, es codiert folglich für die übrig bleibende Amino- säure Thr. Codon-Bevorzugung (Zettelkasten Seite 22) 1 Die Codon-Bevorzugung spiegelt sich in der Konzentration der t-RNA-Moleküle wider. Welches Problem kann auftreten, wenn man ein Gen, beispielsweise von Escherichia coli, auf Saccharomyces frugiperda über- trägt, um das zugehörige Protein herstellen zu lassen? Die Biosynthese des Proteins aus E. coli kann ineffektiv sein, wenn in S. frugiperda das Codon CCG sehr viel seltener verwen- det wird, da die Konzentration der entsprechenden t-RNA dann ebenfalls sehr niedrig ist. Translation: Ein Protein entsteht (Seite 23) RNA und Proteine gehören unterschiedlichen chemischen Stoffklassen an. Dennoch gibt es strukturelle und funktionelle Paral- lelen. Begründen Sie. t-RNA-Moleküle sind wie Proteine dreidimensionale Gebilde. Erst ihre Raumstruktur ermöglicht es ihnen, ihre Funktion auszu- führen. Beispielsweise erkennen t-RNA-Moleküle die passenden Aminoaceyl-t-RNA-Synthetasen aufgrund ihrer räumlichen Passung nach dem Schlüssel-Schloss-Prinzip. 2 Das Codon AUG hat zwei verschiedene Bedeutungen, je nachdem ob es sich am Anfang einer m-RNA oder nicht befindet. Begründen Sie. Als Startcodon markiert AUG auf einer m-RNA den Beginn der Translation, fungiert also als „Satzzeichen“. Methionin ist dem- gemäß die erste Aminosäure eines Proteins, die aber meist bei der Reifung von Proteinen wieder abgespalten wird. Innerhalb eines Proteins codiert das Codon AUG lediglich für die Aminosäure Methionin und hat darüber hinaus keine weitere Bedeutung. 3 Formulieren Sie zu dem codogenen DNA-Abschnitt unten die komplementäre m-RNA. Formulieren Sie dann die komplementä- ren Anticodons und die zugehörigen Aminosäuren: 3'CTGGCTTGAACCCGCTTC5¹ Die Sequenz der m-RNA lautet: 5'GACCGAACUUGGGCGAAG3¹ Die Sequenzen der Anticodons lauten: 3'CUG-GCU-UGA-ACC-CGC-UUC5* Die Aminosäuresequenz lautet: Aps-Arg-Thr-Trp-Ala-Lys Proteinbiosynthese bei Eukaryoten (Seite 25) Menschliches Insulin kann von „umprogrammierten" Bakterienzellen erzeugt werden. Man überträgt dazu die für Inuslin codie- rende Nucleinsäure. Mit welchen Schwierigkeiten ist aufgrund der unterschiedlichen Proteinbiosynthese von Pro- und Eukaryo- ten zu rechnen? Eukaryotische Gene sind gestückelt, prokaryotische hingegen nicht. Das heißt, würde das Insulin-Gen auf Bakterien übertra- gen, könnten die Introns nicht entfernt werden, da Prokaryoten die entsprechenden Spleiß-Enzyme nicht besitzen. Die Protein- biosynthese des Insulins gelänge nicht. Um dieses Problem zu umgehen, schreibt man die Insulin-m-RNA, die aufgrund des Spleißens keine Introns mehr aufweist, mithilfe des Enzyms Reverse Transkriptase in c-DNA und überträgt sie auf Bakterien. 5