Biologie /

Gentechnik

Gentechnik

user profile picture

Celine

370 Followers
 

Biologie

 

11/12

Klausur

Gentechnik

 per!
Biologie b2 GK, Br
Nam
5'
BIOLOGIE-KLAUSUR KS 12.1
Punkte: 22/23 VP
Durchschnitt: 9,8
mdl: 15 NP
3'
Aufgabe 1( 4 1 4 Punkte)
Restrikti
 per!
Biologie b2 GK, Br
Nam
5'
BIOLOGIE-KLAUSUR KS 12.1
Punkte: 22/23 VP
Durchschnitt: 9,8
mdl: 15 NP
3'
Aufgabe 1( 4 1 4 Punkte)
Restrikti

Kommentare (3)

Teilen

Speichern

126

Klassenarbeit, Klasse 12, Grundkurs Themen: Gentechnik, Plasmide, Bakterien, STRs, Kettenabbruchmethode nach Sanger

Nichts passendes dabei? Erkunde andere Fachbereiche.

per! Biologie b2 GK, Br Nam 5' BIOLOGIE-KLAUSUR KS 12.1 Punkte: 22/23 VP Durchschnitt: 9,8 mdl: 15 NP 3' Aufgabe 1( 4 1 4 Punkte) Restriktionsenzyme können DNA-Stränge zerschneiden. Das wird bei vielen wichtigen Vorgängen benötigt, wie z.B. bei der Rekombination, der Reparatur von Mutationen in der DNA oder auch beim Abbau unerwünschter Fremd-DNA. Restriktionsenzyme sind auch ein sehr wichtiges Werkzeug bei gentechnischen Experimenten. Bei Spezialfirmen kann man heute Hunderte verschiedener Restriktionsenzyme per Katalog bestellen, z.B. das Restriktionsenzym EcoRI. Dieses besitzt die Erkennungssequenz 5'-GAATTC-3' und schneidet hier zwischen den Basen G und A. Abbildung 1 zeigt eine Plasmidsequenz an, welche mit dem Enzym geschnitten werden soll. GACCTCTGGTGGATCC CAGCAAGGAATTCAGTTAGC CTG GAGACCACCTAGGGTCGTTCCTTAAGTCAATCG Aufgabe 2¹( 5 5 Punkte) Bei einem Raubüberfall wehrt sich das Opfer erfolgreich durch Kratzen, der Täter entkommt. Hautpartikel und Blutspuren des Täters werden vorsichtig von den Fingerspitzen des Opfers entfernt und als Beweismaterial sichergestellt. Später werden aufgrund der Täterbeschreibung zwei verdächtige Personen festgenommen. Abbildung 2 zeigt die Gel-Elektrophorese-Ergebnisse des genetischen Fingerabdrucks. Hierfür wurden mehrere STRS analysiert, die auf verschiedenen Chromosomen liegen. ad Erklären Sie, was STRS sind und wieso sie es ermöglichen Personen eindeutig zu identifizieren. (3 VP) Abb. 1 a) Erläutern Sie, was man unter einem Plasmid versteht und nennen Sie eine Anwendung von Plasmiden in der Gentechnik. (2 VP) 2 blauen Strichen Zeichnen Sie in Abbildung 1 ein, an welchen Stellen das Enzym EcoRI die DNA schneidet. (0,5 VP) an den Beim...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

Schneiden der DNA mit EcoRI entstehen überstehende Enden. Erläutern Sie deren Bedeutung für die Gentechnik. (1,5 VP) M Auf der Rückseite geht es weiter! 2 3 Note: 15 NP B b) Ziehen Sie aus dem Bandenmuster der Gelelektrophorese Schlussfolgerungen zur Verbrechensaufklärung (Abb. 2). Begründen Sie ihre 7 Entscheidung. (2 VP) Jhe || 3 9 10 11 Opfer 3' 09.11.2020 5' Beweismat. 1. Verdächt. | || | 1 0110 2. Verdächt 1001 || Abb. 2 Aufgabe 3 ( 7 7 Punkte) Das Schema (siehe Abb. 3) zeigt die gentechnische Herstellung und Selektion transgener Zellen. a) Ordnen Sie den Zahlen im Schema eine Beschriftung zu. Benennen Sie dabei die dargestellten Elemente und Grundoperationen der Gentechnik. (4 VP) / 4 1 DNA aus Spenderorganismus ✓ 2 Zerschneiden durch ein R. enzym ✓ Fremd-DNA 3 ✓ 4 Plasmid 5 Aufschneiden d. Plasmids * DNA aus-Spenderorganismus Einfügen der Fremd-DNA Fremd-DNA 6 Schnittstelle d. R. enzyms 7 Einfügen der Fremd-DNAV Nährboden mit Ampicillin (*) 8 verbinden durch DNA-Ligase ✓ Nährboden mit Tetracyclin (*) Plasmid Plasmid mit Fremd-DNA Plasmid ohne Fremd-DNA ✓ In alphabetischer Reihenfolge: Aufschmeiden des Plasmids durch das Restriktionsenzym Bakterienkolonien Bakterium mit Plasmid mit Fremd-DNA Bakterium mit Plasmid ohne Fremd-DNA Bakterium ohne Plasmid 9 Plasmich mit Fremd-DNA 10 Plasmid ohne Fremd-ONA 11 Ampicillin-Resistenzgen 12 Tetracyclin-Resistenzgen & Schnittstelle des Restriktionsenzyms Selektion von Bakterien mit Plasmid Selektion von Bakterien ohne Fremd-DNA Transformation von Bakterien Übertragen der Kolonien mit einem Samtstempel Verbinden durch DNA-Ligase Zerschneiden durch ein Restriktionsenzym 13 Transformation v. Bakterien 14 B. mit Plasmid mit Fremd-DNA 15 B. mit Plasmid ohne Fremd-DNAV 16 17 Bakterium ohne Plasmid Selektion v. B. mit Plasmid ✓ 18 Nahrboden mit Tetracydin✓ 19 Bakterenkolonien ✓ 20 übertragen d. kalonien m.e. Samtstempelv 21 Selektion v. B. ohne Fremd-DNAV 22 Nomboden mit Ampicillin ✓ clurch das Restrictionsenzym Hinweis: (*) Ampicillin und Tetracyclin sind Antibiotika, die Bakterien abtöten. Nennen Sie die im in Versuch (Abb. 2) verwendeten Markergene. Erklären Sie die Funktion der Markergene in dem dargestellten Versuch. (3 VP) 4 Aufgabe 4 (4/4 Punkte) Mithilfe der Kettenabbruchmethode nach Sanger kann eine unbekannte DNA-Sequenz entschlüsselt werden. Die unbekannte, vervielfältigte DNA wird dabei in vier Ansätzen mit allen benötigten Stoffen zusammengebracht: passende Primer (radioaktiv markiert), DNA-Polymerase, eine Vielzahl normaler Nukleotide, einige Abbruchnukleotide. Abb. 4 zeigt das Ergebnis einer Gelelektrophorese bei einer DNA- Sequenzierung. lange Fragmente kurze Fragmente Elektrophoreserichtung АПТПС — — - BIGOTTICE TOUT FROM 5' 3' Abb. 4 a) Benennen Sie den Prozess, bei dem die DNA-Polymerase in der Zelle eine Schlüsselrolle spielt. (0,5 VP) Durch die Zugabe von Abbruchnukleotiden entstehen in jedem Sequenzieransatz unterschiedlich lange Fragmente. Erläutern Sie diesen Zusammenhang. (2 VP) c) Leiten Sie aus dem Ergebnis der Gelelektrophorese (Abb. 3) die ursprüngliche DNA-Sequenz (in 3' - 5'- Richtung) ab. (1,5 VP) Aufgabe ( 2 / 3 Punkte) Positiv getestet, aber nicht ansteckend Bereits im März hatte sich Philipp Traxel mit dem Coronavirus infiziert, vermutlich bei einem Kurzurlaub in Paris mit zwei Freunden. Wenige Tage nach seiner Rückkehr bekam der 28-jährige Rheinländer leichtes Fieber und Kopfschmerzen. Der Test bei seiner Hausärztin war positiv. So wie viele andere Infizierte hatte er seinen Geschmackssinn verloren und keinen Appetit. (...) Im September brach Traxel dann gemeinsam mit seiner Freundin zu einer Urlaubsreise nach Portugal auf. Als sie nach einer Woche wieder auf dem Köln-Bonner Flughafen landeten, machte er als Reiserückkehrer den verpflichtenden Corona-Test - und war angeblich wieder positiv. Beschreiben Sie das Ziel einer PCR (Polymerasekettenreaktion). (1 VP) Erklären Sie den Zusammenhang zwischen dem Ct-Wert und der Virusmenge in der Probe. (2 VP) Wie kann das sein? Das Robert-Koch-Institut (RKI) weist aktuell darauf hin, dass Infizierte auch "noch Wochen nach dem Symptombeginn" positiv getestet werden können. "Dass diese positiven PCR-Ergebnisse bei genesenen Patienten nicht mit Ansteckungsfähigkeit gleichzusetzen ist, wurde in mehreren Analysen gezeigt", schreibt das RKI. Ob jemand trotz eines positiven Corona-Tests nicht mehr ansteckend ist, kann der sogenannte Ct-Wert zeigen. Dieser Laborwert gibt an, wie viele Zyklen ein PCR-Test durchlaufen musste, um ein positives Ergebnis zu zeigen. Je höher der Wert, desto weniger Virusmenge ist vorhanden. (...) Quelle: Süddeutsche Zeitung, 7. Oktober 2020 Viel Erfolg! S2 8. (14) 18 S o O 19 0° 00 0% o Auf der Rückseite geht es weiter! Ampic Tetragci. X ✓ Abb. 3 Aufgabe 1: Plasmide Sind kleine, ningförmige DNA- Molekule. Sie besitzen eine begrenzte ✓ Anzahl von Genen, replizieren sich un- abnangig können unter Bakterien der ausgetauscht werden. Sie dienen in Gentechnik als vekter: fremde DNA wird eingeschleust, sodass ein eiu Plosmid Baktenum, das C in Plasmid neue Biologie KA 1 und herstellen, besitzt. aufgenommen hat (Transformation), Eigenschaften, wie insuliu dieses rekombinante Sich eutym daun entstehen ✓ Diese ends) können mit überstehenden Enden (Sticky Z.B. komplementoren Einzelstrauguberhaug Basen- paarungen eingehen, wenn. einer anderen Stelle das mit einem anderen, greiche Restriktious- die DNA geschnitten hat, da die gleichen Restriktious fragmente Die Sticky ends können aber auch wieder gleich zusammen legen. Dies wichtig für den Eubau fremder ONA I eines fremden ist wichtig Gens in ein Plasmid, da dies funktioniert, wenn beide die gleichen Sticky ends besitzen. au nur ✓ 2 Vf 1,5P 3 VP Aufgabe 2 den a) STRS (shart tandem repeats) findet man in Introns der DNA, das heißt die Bereiche, für ein Gen coderen. In den STRS gibt es eine Basen abfolge (z. B. GTCCA) die jedoch clie nicht bei jedem Menschen unterschiedlich oft wiederholt wird Diese Sch clamit werden Anzahl wenn Sehr das van deu Anzahl auch kann man einem Anzaul an hoher eine Sich die gesucute STR haben, Eltern Jeder der wiederholungen vererbt die Wiederholungen. mehrere Wahrscheinlichkeit Person Sehr können auf Vaterschaft bewiesen Mensch iSt dies sind eineiige Zwillinge) (b) Der Bei dem van Spitzen dabei und wenn man Sich ansieut, sieht man, und beim Senen deswegen ist daher Menschen Tater. STRS vom das Bewersmaterial wurde von entfernt, daher ist die hat dass Kinder, sodass ist. Denn doch bei unwahrscheinlich (außer es 2 verdächtige 2 War Sind Hautpartikel Beweismaterial Opfer (da es sich gewehrt hat und eine sagen, dass bei die gleiche mehreren (min. 9) beim kann man, ansieht, mit 4. Bande auch andere ein nur der Tater. ✓ den Finger- verdachtigen a bem dieses Hautpartikel beim dessen DNA van oben Beweismaterial snich ғи Opfer allerdings nicht. Beweis ( vom es dass seiu aber Das Tater. Bei das es Aufgabe 3: (b) kann, nicht 2. DOS Plasmid Plasmid ein wachsen. Tetracylin Fremd-DUA gleiche Bei nicht 1 Ampicillin-Resistenzgen (2. Tetracycliu-Resistenzgen da beim können Bakeren Bande Bande 3 der verdächtige 1 gewesen. es dort nur bei ihm, einen Strich gibt Ⓒ'Tetracyclin - Resistenzgen hat die Funktion, e Baktenen ohne Plasmid von unterscheiden. Bakterien ohne auf dem noch besitzt die man zu wachsen Beweis nicht; und 7 von nur identifikation cier Fremd - DNA. Bakterien die oben ist Nachweis ohne Fremd-DNA konnen sieht man, Ampicillin-Resistenz gen client der Selektion Baktenen mit und ohne Fremd-DNA haben funktionierendes Ampi.- Res. - Gen und Nahrboden wachsen. somit auf dem mit Fremd-DNA haben kein intaktes und ✓ denen beide und unterscheiden kann sucut (mit Fremdgen) Nahrboden mit Bakterien mit mit Somit Ampic-Res. Gen wachsen. Beim und Fremdgens ist Sinnvoller das Markergen ß-Galaktosidase zu benutzen und dieses zu zerschneiden, da 11017 dem können dine nicht Einbau eines man am Ende Kolonien (mit und ohne Fremdgen) und nicht die, abgestaben sind. 2 VP 9VS 3 VP 0,S VP 2 VP 1,5 VP 1 VP 1 VP Aufgabe 4: a) DNA-Replikation ✓ (b) Abbruchnukleotide besitzen anstatt einer OH-Gruppe nur eine H-Gruppe. An diese kann Sicu kein Nukleotid binden, deswegen endet dort die Vervollständigung. Die normalen v Nukleotide werden zu den verhaltuis 2001 Abbruchnukleotiden gegeben, sodass es immer weiteres ersten auch langer werden langen sind der Baseuabfolge waren man 2 beim sie uicut eutschlüsseln. 3' GATTC GA essentiell für die in Aufgabe 5: Durch Abschnitt vervielfältigt b) Je weniger Virusmenge sich in der Probe befindet, after läuft die PCR durch, die PCR soll abbricht, sondern der Strang Die unterschiedlichen kaun. Entschlüsselung alle gleich laug, könnte ✓ Je höher Virusmenge um es da ist.* ist die PCR der Ct-weit. ist um zu suchen werden. ✓ kurzer Zeit uruserbgut nach desto So oft zu vervielfältigen, dass grung" ² Bei einer niedrigen Vilusmenge muss durchlaufen, dadurch also häufig sehr hoch (> viele Zyklen). desto weniger dieser ist der 5' ✓ nicut ein bestimmter DNA- in großen Mengen PCR Ct - weit, Ja handen. nach ug Welche Zylles laufen ab? dieser Menge 1]

Biologie /

Gentechnik

Gentechnik

user profile picture

Celine

370 Followers
 

Biologie

 

11/12

Klausur

Gentechnik

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 per!
Biologie b2 GK, Br
Nam
5'
BIOLOGIE-KLAUSUR KS 12.1
Punkte: 22/23 VP
Durchschnitt: 9,8
mdl: 15 NP
3'
Aufgabe 1( 4 1 4 Punkte)
Restrikti

App öffnen

Teilen

Speichern

126

Kommentare (3)

B

Vielen Dank, wirklich hilfreich für mich, da wir gerade genau das Thema in der Schule haben 😁

Klassenarbeit, Klasse 12, Grundkurs Themen: Gentechnik, Plasmide, Bakterien, STRs, Kettenabbruchmethode nach Sanger

Ähnliche Knows

Gentechnische Werkzeuge & Verfahren | Genetik

Know Gentechnische Werkzeuge & Verfahren | Genetik thumbnail

395

 

11/12/13

2

Plasmide als Vektoren/Selektion

Know Plasmide als Vektoren/Selektion thumbnail

13

 

12/13

2

Grundoperationen der Gentechnik (LK)

Know Grundoperationen der Gentechnik (LK) thumbnail

87

 

12

11

Gentechnik & Humangenetik

Know Gentechnik & Humangenetik thumbnail

86

 

11/12/13

Mehr

per! Biologie b2 GK, Br Nam 5' BIOLOGIE-KLAUSUR KS 12.1 Punkte: 22/23 VP Durchschnitt: 9,8 mdl: 15 NP 3' Aufgabe 1( 4 1 4 Punkte) Restriktionsenzyme können DNA-Stränge zerschneiden. Das wird bei vielen wichtigen Vorgängen benötigt, wie z.B. bei der Rekombination, der Reparatur von Mutationen in der DNA oder auch beim Abbau unerwünschter Fremd-DNA. Restriktionsenzyme sind auch ein sehr wichtiges Werkzeug bei gentechnischen Experimenten. Bei Spezialfirmen kann man heute Hunderte verschiedener Restriktionsenzyme per Katalog bestellen, z.B. das Restriktionsenzym EcoRI. Dieses besitzt die Erkennungssequenz 5'-GAATTC-3' und schneidet hier zwischen den Basen G und A. Abbildung 1 zeigt eine Plasmidsequenz an, welche mit dem Enzym geschnitten werden soll. GACCTCTGGTGGATCC CAGCAAGGAATTCAGTTAGC CTG GAGACCACCTAGGGTCGTTCCTTAAGTCAATCG Aufgabe 2¹( 5 5 Punkte) Bei einem Raubüberfall wehrt sich das Opfer erfolgreich durch Kratzen, der Täter entkommt. Hautpartikel und Blutspuren des Täters werden vorsichtig von den Fingerspitzen des Opfers entfernt und als Beweismaterial sichergestellt. Später werden aufgrund der Täterbeschreibung zwei verdächtige Personen festgenommen. Abbildung 2 zeigt die Gel-Elektrophorese-Ergebnisse des genetischen Fingerabdrucks. Hierfür wurden mehrere STRS analysiert, die auf verschiedenen Chromosomen liegen. ad Erklären Sie, was STRS sind und wieso sie es ermöglichen Personen eindeutig zu identifizieren. (3 VP) Abb. 1 a) Erläutern Sie, was man unter einem Plasmid versteht und nennen Sie eine Anwendung von Plasmiden in der Gentechnik. (2 VP) 2 blauen Strichen Zeichnen Sie in Abbildung 1 ein, an welchen Stellen das Enzym EcoRI die DNA schneidet. (0,5 VP) an den Beim...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen

Alternativer Bildtext:

Schneiden der DNA mit EcoRI entstehen überstehende Enden. Erläutern Sie deren Bedeutung für die Gentechnik. (1,5 VP) M Auf der Rückseite geht es weiter! 2 3 Note: 15 NP B b) Ziehen Sie aus dem Bandenmuster der Gelelektrophorese Schlussfolgerungen zur Verbrechensaufklärung (Abb. 2). Begründen Sie ihre 7 Entscheidung. (2 VP) Jhe || 3 9 10 11 Opfer 3' 09.11.2020 5' Beweismat. 1. Verdächt. | || | 1 0110 2. Verdächt 1001 || Abb. 2 Aufgabe 3 ( 7 7 Punkte) Das Schema (siehe Abb. 3) zeigt die gentechnische Herstellung und Selektion transgener Zellen. a) Ordnen Sie den Zahlen im Schema eine Beschriftung zu. Benennen Sie dabei die dargestellten Elemente und Grundoperationen der Gentechnik. (4 VP) / 4 1 DNA aus Spenderorganismus ✓ 2 Zerschneiden durch ein R. enzym ✓ Fremd-DNA 3 ✓ 4 Plasmid 5 Aufschneiden d. Plasmids * DNA aus-Spenderorganismus Einfügen der Fremd-DNA Fremd-DNA 6 Schnittstelle d. R. enzyms 7 Einfügen der Fremd-DNAV Nährboden mit Ampicillin (*) 8 verbinden durch DNA-Ligase ✓ Nährboden mit Tetracyclin (*) Plasmid Plasmid mit Fremd-DNA Plasmid ohne Fremd-DNA ✓ In alphabetischer Reihenfolge: Aufschmeiden des Plasmids durch das Restriktionsenzym Bakterienkolonien Bakterium mit Plasmid mit Fremd-DNA Bakterium mit Plasmid ohne Fremd-DNA Bakterium ohne Plasmid 9 Plasmich mit Fremd-DNA 10 Plasmid ohne Fremd-ONA 11 Ampicillin-Resistenzgen 12 Tetracyclin-Resistenzgen & Schnittstelle des Restriktionsenzyms Selektion von Bakterien mit Plasmid Selektion von Bakterien ohne Fremd-DNA Transformation von Bakterien Übertragen der Kolonien mit einem Samtstempel Verbinden durch DNA-Ligase Zerschneiden durch ein Restriktionsenzym 13 Transformation v. Bakterien 14 B. mit Plasmid mit Fremd-DNA 15 B. mit Plasmid ohne Fremd-DNAV 16 17 Bakterium ohne Plasmid Selektion v. B. mit Plasmid ✓ 18 Nahrboden mit Tetracydin✓ 19 Bakterenkolonien ✓ 20 übertragen d. kalonien m.e. Samtstempelv 21 Selektion v. B. ohne Fremd-DNAV 22 Nomboden mit Ampicillin ✓ clurch das Restrictionsenzym Hinweis: (*) Ampicillin und Tetracyclin sind Antibiotika, die Bakterien abtöten. Nennen Sie die im in Versuch (Abb. 2) verwendeten Markergene. Erklären Sie die Funktion der Markergene in dem dargestellten Versuch. (3 VP) 4 Aufgabe 4 (4/4 Punkte) Mithilfe der Kettenabbruchmethode nach Sanger kann eine unbekannte DNA-Sequenz entschlüsselt werden. Die unbekannte, vervielfältigte DNA wird dabei in vier Ansätzen mit allen benötigten Stoffen zusammengebracht: passende Primer (radioaktiv markiert), DNA-Polymerase, eine Vielzahl normaler Nukleotide, einige Abbruchnukleotide. Abb. 4 zeigt das Ergebnis einer Gelelektrophorese bei einer DNA- Sequenzierung. lange Fragmente kurze Fragmente Elektrophoreserichtung АПТПС — — - BIGOTTICE TOUT FROM 5' 3' Abb. 4 a) Benennen Sie den Prozess, bei dem die DNA-Polymerase in der Zelle eine Schlüsselrolle spielt. (0,5 VP) Durch die Zugabe von Abbruchnukleotiden entstehen in jedem Sequenzieransatz unterschiedlich lange Fragmente. Erläutern Sie diesen Zusammenhang. (2 VP) c) Leiten Sie aus dem Ergebnis der Gelelektrophorese (Abb. 3) die ursprüngliche DNA-Sequenz (in 3' - 5'- Richtung) ab. (1,5 VP) Aufgabe ( 2 / 3 Punkte) Positiv getestet, aber nicht ansteckend Bereits im März hatte sich Philipp Traxel mit dem Coronavirus infiziert, vermutlich bei einem Kurzurlaub in Paris mit zwei Freunden. Wenige Tage nach seiner Rückkehr bekam der 28-jährige Rheinländer leichtes Fieber und Kopfschmerzen. Der Test bei seiner Hausärztin war positiv. So wie viele andere Infizierte hatte er seinen Geschmackssinn verloren und keinen Appetit. (...) Im September brach Traxel dann gemeinsam mit seiner Freundin zu einer Urlaubsreise nach Portugal auf. Als sie nach einer Woche wieder auf dem Köln-Bonner Flughafen landeten, machte er als Reiserückkehrer den verpflichtenden Corona-Test - und war angeblich wieder positiv. Beschreiben Sie das Ziel einer PCR (Polymerasekettenreaktion). (1 VP) Erklären Sie den Zusammenhang zwischen dem Ct-Wert und der Virusmenge in der Probe. (2 VP) Wie kann das sein? Das Robert-Koch-Institut (RKI) weist aktuell darauf hin, dass Infizierte auch "noch Wochen nach dem Symptombeginn" positiv getestet werden können. "Dass diese positiven PCR-Ergebnisse bei genesenen Patienten nicht mit Ansteckungsfähigkeit gleichzusetzen ist, wurde in mehreren Analysen gezeigt", schreibt das RKI. Ob jemand trotz eines positiven Corona-Tests nicht mehr ansteckend ist, kann der sogenannte Ct-Wert zeigen. Dieser Laborwert gibt an, wie viele Zyklen ein PCR-Test durchlaufen musste, um ein positives Ergebnis zu zeigen. Je höher der Wert, desto weniger Virusmenge ist vorhanden. (...) Quelle: Süddeutsche Zeitung, 7. Oktober 2020 Viel Erfolg! S2 8. (14) 18 S o O 19 0° 00 0% o Auf der Rückseite geht es weiter! Ampic Tetragci. X ✓ Abb. 3 Aufgabe 1: Plasmide Sind kleine, ningförmige DNA- Molekule. Sie besitzen eine begrenzte ✓ Anzahl von Genen, replizieren sich un- abnangig können unter Bakterien der ausgetauscht werden. Sie dienen in Gentechnik als vekter: fremde DNA wird eingeschleust, sodass ein eiu Plosmid Baktenum, das C in Plasmid neue Biologie KA 1 und herstellen, besitzt. aufgenommen hat (Transformation), Eigenschaften, wie insuliu dieses rekombinante Sich eutym daun entstehen ✓ Diese ends) können mit überstehenden Enden (Sticky Z.B. komplementoren Einzelstrauguberhaug Basen- paarungen eingehen, wenn. einer anderen Stelle das mit einem anderen, greiche Restriktious- die DNA geschnitten hat, da die gleichen Restriktious fragmente Die Sticky ends können aber auch wieder gleich zusammen legen. Dies wichtig für den Eubau fremder ONA I eines fremden ist wichtig Gens in ein Plasmid, da dies funktioniert, wenn beide die gleichen Sticky ends besitzen. au nur ✓ 2 Vf 1,5P 3 VP Aufgabe 2 den a) STRS (shart tandem repeats) findet man in Introns der DNA, das heißt die Bereiche, für ein Gen coderen. In den STRS gibt es eine Basen abfolge (z. B. GTCCA) die jedoch clie nicht bei jedem Menschen unterschiedlich oft wiederholt wird Diese Sch clamit werden Anzahl wenn Sehr das van deu Anzahl auch kann man einem Anzaul an hoher eine Sich die gesucute STR haben, Eltern Jeder der wiederholungen vererbt die Wiederholungen. mehrere Wahrscheinlichkeit Person Sehr können auf Vaterschaft bewiesen Mensch iSt dies sind eineiige Zwillinge) (b) Der Bei dem van Spitzen dabei und wenn man Sich ansieut, sieht man, und beim Senen deswegen ist daher Menschen Tater. STRS vom das Bewersmaterial wurde von entfernt, daher ist die hat dass Kinder, sodass ist. Denn doch bei unwahrscheinlich (außer es 2 verdächtige 2 War Sind Hautpartikel Beweismaterial Opfer (da es sich gewehrt hat und eine sagen, dass bei die gleiche mehreren (min. 9) beim kann man, ansieht, mit 4. Bande auch andere ein nur der Tater. ✓ den Finger- verdachtigen a bem dieses Hautpartikel beim dessen DNA van oben Beweismaterial snich ғи Opfer allerdings nicht. Beweis ( vom es dass seiu aber Das Tater. Bei das es Aufgabe 3: (b) kann, nicht 2. DOS Plasmid Plasmid ein wachsen. Tetracylin Fremd-DUA gleiche Bei nicht 1 Ampicillin-Resistenzgen (2. Tetracycliu-Resistenzgen da beim können Bakeren Bande Bande 3 der verdächtige 1 gewesen. es dort nur bei ihm, einen Strich gibt Ⓒ'Tetracyclin - Resistenzgen hat die Funktion, e Baktenen ohne Plasmid von unterscheiden. Bakterien ohne auf dem noch besitzt die man zu wachsen Beweis nicht; und 7 von nur identifikation cier Fremd - DNA. Bakterien die oben ist Nachweis ohne Fremd-DNA konnen sieht man, Ampicillin-Resistenz gen client der Selektion Baktenen mit und ohne Fremd-DNA haben funktionierendes Ampi.- Res. - Gen und Nahrboden wachsen. somit auf dem mit Fremd-DNA haben kein intaktes und ✓ denen beide und unterscheiden kann sucut (mit Fremdgen) Nahrboden mit Bakterien mit mit Somit Ampic-Res. Gen wachsen. Beim und Fremdgens ist Sinnvoller das Markergen ß-Galaktosidase zu benutzen und dieses zu zerschneiden, da 11017 dem können dine nicht Einbau eines man am Ende Kolonien (mit und ohne Fremdgen) und nicht die, abgestaben sind. 2 VP 9VS 3 VP 0,S VP 2 VP 1,5 VP 1 VP 1 VP Aufgabe 4: a) DNA-Replikation ✓ (b) Abbruchnukleotide besitzen anstatt einer OH-Gruppe nur eine H-Gruppe. An diese kann Sicu kein Nukleotid binden, deswegen endet dort die Vervollständigung. Die normalen v Nukleotide werden zu den verhaltuis 2001 Abbruchnukleotiden gegeben, sodass es immer weiteres ersten auch langer werden langen sind der Baseuabfolge waren man 2 beim sie uicut eutschlüsseln. 3' GATTC GA essentiell für die in Aufgabe 5: Durch Abschnitt vervielfältigt b) Je weniger Virusmenge sich in der Probe befindet, after läuft die PCR durch, die PCR soll abbricht, sondern der Strang Die unterschiedlichen kaun. Entschlüsselung alle gleich laug, könnte ✓ Je höher Virusmenge um es da ist.* ist die PCR der Ct-weit. ist um zu suchen werden. ✓ kurzer Zeit uruserbgut nach desto So oft zu vervielfältigen, dass grung" ² Bei einer niedrigen Vilusmenge muss durchlaufen, dadurch also häufig sehr hoch (> viele Zyklen). desto weniger dieser ist der 5' ✓ nicut ein bestimmter DNA- in großen Mengen PCR Ct - weit, Ja handen. nach ug Welche Zylles laufen ab? dieser Menge 1]