Biologie /

Chromosomen & DNA zu Chromosomen

Chromosomen & DNA zu Chromosomen

user profile picture

Pauline

16 Followers
 

Biologie

 

11/12

Lernzettel

Chromosomen & DNA zu Chromosomen

 P-
Arm
4-
Arm
Telomer
(Ende)
chromosomen
centromer
Chromatid
→・fadenartige struktur im Zellkern von eukaryotischen Zellen
´ „ kleinste / di
 P-
Arm
4-
Arm
Telomer
(Ende)
chromosomen
centromer
Chromatid
→・fadenartige struktur im Zellkern von eukaryotischen Zellen
´ „ kleinste / di

Kommentare (4)

Teilen

Speichern

118

- Chromosomen Aufbau - wie sich DNA zum Chromosomen verdichtet - autosom/gonosom - haploid/diploid

Nichts passendes dabei? Erkunde andere Fachbereiche.

P- Arm 4- Arm Telomer (Ende) chromosomen centromer Chromatid →・fadenartige struktur im Zellkern von eukaryotischen Zellen ´ „ kleinste / dichteste“ Verpackung der DNA langer strang aus DNA, der als Doppelhelix um eine Vielzahl von Histonen herum - gewickelt ist 8 Autosom: Nicht - Geschlechts - Chromosomen" Der Mensch besitzt in jeder körperzelle 46 Chromosomen. Davon sind 22 je 2x vorhanden. -> Mitose Gonosom: • Geschlechts - chromosomen 2-C-C Gonosomen sind die beiden chromosomen (x,y) die das Geschlecht bestimmen -> Meiose haploid: einfacher chromosomensatz (n₁ 23) keimzellen sind haploid (Genom liegt 1x vor) Eizellen und spermiemzellen haben von jedem chromosomenpaar entweder nur das chromosom von der Mutter oder das vom Vater. diploid: doppelter chromosomensatz (2n, 46) Körperzellen haben einen diploiden chromosomensatz (Genom liegt 2x vor) 1-C-C CHI DATUD 20 C CD identische chromatiden Pärchen sind homolog gleiche Form gleiche Größe gleiche Bänderung ,,verpackung" dna fee TTTT Chromosome Chromatin Histones -Erbsubstanz DNA & Proteine bilden zusammen L> komplex DNA + Protein = Chromatin zentralen Bestandteile der eukaryotischen chromosomen D kondensiert zu chromosomen ·basische Proteine, die einen hohen Anteil geladener Aminosäuren enthalten → binden an geladenes zucker-phosphat-Rückrat der DNA Histon DNA Strang wickelt sich um Octahiston (8 Histon komplex) = Nukleosom (Grundeinheit der DNA-verpackung) Linker ONA = Bereich, indem die DNA für kurze Abschnitte freiliegt Nukleasom ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT DNA helix Einzelstrang der DNA mit komplementärem strang Doppelhelix mit komplementären Basenpaaren verdichtet sich zu Chromatin

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Biologie /

Chromosomen & DNA zu Chromosomen

Chromosomen & DNA zu Chromosomen

user profile picture

Pauline

16 Followers
 

Biologie

 

11/12

Lernzettel

Chromosomen & DNA zu Chromosomen

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 P-
Arm
4-
Arm
Telomer
(Ende)
chromosomen
centromer
Chromatid
→・fadenartige struktur im Zellkern von eukaryotischen Zellen
´ „ kleinste / di

App öffnen

Teilen

Speichern

118

Kommentare (4)

N

Cool, mit dem Lernzettel konnte ich mich richtig gut auf meine Klassenarbeit vorbereiten. Danke 👍👍

- Chromosomen Aufbau - wie sich DNA zum Chromosomen verdichtet - autosom/gonosom - haploid/diploid

Ähnliche Knows

1

Aufbau von Chromosomen

Know Aufbau von Chromosomen thumbnail

31

 

11/12/10

KS1: Genetik

Know   KS1: Genetik thumbnail

185

 

11/12

50

Genetik (Grundlagen, Mitose+Meiose, Proteinbiosynthese, DNA-Replikation, Stammbaumanalyse,…))

Know Genetik   (Grundlagen, Mitose+Meiose, Proteinbiosynthese, DNA-Replikation, Stammbaumanalyse,…))  thumbnail

308

 

12/13

Chromosomen

Know Chromosomen thumbnail

497

 

11/12/10

Mehr

P- Arm 4- Arm Telomer (Ende) chromosomen centromer Chromatid →・fadenartige struktur im Zellkern von eukaryotischen Zellen ´ „ kleinste / dichteste“ Verpackung der DNA langer strang aus DNA, der als Doppelhelix um eine Vielzahl von Histonen herum - gewickelt ist 8 Autosom: Nicht - Geschlechts - Chromosomen" Der Mensch besitzt in jeder körperzelle 46 Chromosomen. Davon sind 22 je 2x vorhanden. -> Mitose Gonosom: • Geschlechts - chromosomen 2-C-C Gonosomen sind die beiden chromosomen (x,y) die das Geschlecht bestimmen -> Meiose haploid: einfacher chromosomensatz (n₁ 23) keimzellen sind haploid (Genom liegt 1x vor) Eizellen und spermiemzellen haben von jedem chromosomenpaar entweder nur das chromosom von der Mutter oder das vom Vater. diploid: doppelter chromosomensatz (2n, 46) Körperzellen haben einen diploiden chromosomensatz (Genom liegt 2x vor) 1-C-C CHI DATUD 20 C CD identische chromatiden Pärchen sind homolog gleiche Form gleiche Größe gleiche Bänderung ,,verpackung" dna fee TTTT Chromosome Chromatin Histones -Erbsubstanz DNA & Proteine bilden zusammen L> komplex DNA + Protein = Chromatin zentralen Bestandteile der eukaryotischen chromosomen D kondensiert zu chromosomen ·basische Proteine, die einen hohen Anteil geladener Aminosäuren enthalten → binden an geladenes zucker-phosphat-Rückrat der DNA Histon DNA Strang wickelt sich um Octahiston (8 Histon komplex) = Nukleosom (Grundeinheit der DNA-verpackung) Linker ONA = Bereich, indem die DNA für kurze Abschnitte freiliegt Nukleasom ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT DNA helix Einzelstrang der DNA mit komplementärem strang Doppelhelix mit komplementären Basenpaaren verdichtet sich zu Chromatin

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen