Biologie /

Genetik Bio Abi 2022

Genetik Bio Abi 2022

 Genetik Übersicht
Aufbau DNA
Code Sonne

Genetik Bio Abi 2022

user profile picture

Hanna H








Zusammenfassung Genetik für Gk (NRW)

Nichts passendes dabei? Erkunde andere Fachbereiche.

Genetik Übersicht Zytologie Aufbau DNA DNA-Replikation Proteinbiosynthese Transkription Translation Code Sonne Genregulation Substrat-Induktion Endprodukt-Repression Gentechnik Werkzeuge der Gentechnik Methoden der Gentechnik Bioethik Mutationen Genommutationen Chromosommutationen Genmutationen Meiose Stammbaumanalyse Zytologie Eukaryote Tierzelle Zellmembran- Endoplasmatisches Reticulum (ER) mit Ribosomen Mitochondrien- Lysosomen Pflanzenzelle Cytoplasma Chloroplasten. Zellkern mit Nucleo lus Golgi-Apparat- Vakuole Prokaryote Bakterie Zellmembran Cytoplasma Ribosomen Pili Cytoplasma Zellkem mit Nucleolus Golgi- Apparat Gly koka lix ss Cyto skelett Chromoplast Endoplasmatisches Reticulum (ER) mit Ribosomen Mitochondrien Zellwand Zellwand Nocleoid Plasmid Geißel DNA (DNS) - Desoxyribonukleinsäure DNA = deoxyribonucleic acid (englischer Begriff) DNS = Desoxyribonukleinsäure Was ist die DNA? -> kommt in jeder Zelle des Körpers vor -> Prokaryoten -> schwimmt frei im Cytoplasma -> Die DNA liegt im Zellkern der Eukaryoten, genauer gesagt ist ein Bestandteil der im Zellkern liegenden Chromosomen, die die genetischen Anweisungen gespeichert haben. Nucleotide -> Bausteine der DNA, die zu langen Fäden, der DNA verknüpft werden Bestandteile der Nucleotide: • Desoxyribose (Zucker) CH₂OH 4H H 0 P | NH O OH H • Phosphat O Adenin H O || 0 P 1 OH NH₂ H O™ 0° chemischer Aufbau Uhrzeigersinn nummeriert (wichtig H = Desoxy lohne Sauerstoff deswegen • stickstoffhaltige Base (Adenin (A), Thymin (T), Cytosin (C) und Guanin (G)) ● Im H₂C. O= NH Thymin Chemischer Aufbau Nucleotid: Esterbindung CH₂ 4H NH 13 -> Pyrimidin-Basen - sechseckige Moleküle -> Purin-Basen - OH H3C. NH₂ NH Cytosin H zur nur NH Orientierung! H) NH Guanin fünf- und sechseckiges Gerüst (mit Thymin) NH NH₂ N-glykosidische Bindung Aufbau DNA - zwei antiparallele, umeinander gedrehte Zuckerphosphatbändchen, zwischen denen die Basenpaare strickleiterartig angeordnet sind (5` -> 3' oder 3` -> 5') am 5' Ende befindet sich Phosphat am 3' Ende befindet sich eine OH-Gruppe -> unterschiedliche Enden geben der DNA ihre Orientierung - Struktur einer Doppelhelix - Wasserstoffbrückenbindung zwischen den übereinanderliegenden aromatischen Ringen der Basen (= Stapelkräfte) -> stabilisieren die Raumstruktur -> verknüpfen die Basen (Adenin&Thymin=2, Gunanin&Cytosin=3) - TA-Stapel weniger Stabil (wegen fehlender Aminogruppe bei Thymin) höherer CG-Gehalt = größere Stabilität - die Abfolge der Basen codiert die Erbinformation DNA Verpackung DNA ↓↓ Nucleosomen ↓ Filament ↓ Rosette ↓ Chromatid ↓ Chromosom Rosette Aufgaben der DNA Speicherung der Erbinformationen - Weitergabe der Erbinformationen - Steuerung der Lebensvorgänge - NNN Chromosome Chromatid Filament = Adenin Thymin Cytosin Histones = = Guanin Phosphat- =...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

desoxyribose Strang Eine Gruppe von Proteinen, die wie ,,Lockenwickler" wirken. Dadurch entstehen Nucleosome Nucleosome DNA helix ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT

Biologie /

Genetik Bio Abi 2022

user profile picture

Hanna H  



 Genetik Übersicht
Aufbau DNA
Code Sonne

App öffnen

Zusammenfassung Genetik für Gk (NRW)

Ähnliche Knows

user profile picture



Know Genetik  thumbnail







Know Genetik  thumbnail




user profile picture



Know DNA thumbnail




user profile picture


Die Nucleinsäuren DNA und RNA

Know Die Nucleinsäuren DNA und RNA thumbnail




Genetik Übersicht Zytologie Aufbau DNA DNA-Replikation Proteinbiosynthese Transkription Translation Code Sonne Genregulation Substrat-Induktion Endprodukt-Repression Gentechnik Werkzeuge der Gentechnik Methoden der Gentechnik Bioethik Mutationen Genommutationen Chromosommutationen Genmutationen Meiose Stammbaumanalyse Zytologie Eukaryote Tierzelle Zellmembran- Endoplasmatisches Reticulum (ER) mit Ribosomen Mitochondrien- Lysosomen Pflanzenzelle Cytoplasma Chloroplasten. Zellkern mit Nucleo lus Golgi-Apparat- Vakuole Prokaryote Bakterie Zellmembran Cytoplasma Ribosomen Pili Cytoplasma Zellkem mit Nucleolus Golgi- Apparat Gly koka lix ss Cyto skelett Chromoplast Endoplasmatisches Reticulum (ER) mit Ribosomen Mitochondrien Zellwand Zellwand Nocleoid Plasmid Geißel DNA (DNS) - Desoxyribonukleinsäure DNA = deoxyribonucleic acid (englischer Begriff) DNS = Desoxyribonukleinsäure Was ist die DNA? -> kommt in jeder Zelle des Körpers vor -> Prokaryoten -> schwimmt frei im Cytoplasma -> Die DNA liegt im Zellkern der Eukaryoten, genauer gesagt ist ein Bestandteil der im Zellkern liegenden Chromosomen, die die genetischen Anweisungen gespeichert haben. Nucleotide -> Bausteine der DNA, die zu langen Fäden, der DNA verknüpft werden Bestandteile der Nucleotide: • Desoxyribose (Zucker) CH₂OH 4H H 0 P | NH O OH H • Phosphat O Adenin H O || 0 P 1 OH NH₂ H O™ 0° chemischer Aufbau Uhrzeigersinn nummeriert (wichtig H = Desoxy lohne Sauerstoff deswegen • stickstoffhaltige Base (Adenin (A), Thymin (T), Cytosin (C) und Guanin (G)) ● Im H₂C. O= NH Thymin Chemischer Aufbau Nucleotid: Esterbindung CH₂ 4H NH 13 -> Pyrimidin-Basen - sechseckige Moleküle -> Purin-Basen - OH H3C. NH₂ NH Cytosin H zur nur NH Orientierung! H) NH Guanin fünf- und sechseckiges Gerüst (mit Thymin) NH NH₂ N-glykosidische Bindung Aufbau DNA - zwei antiparallele, umeinander gedrehte Zuckerphosphatbändchen, zwischen denen die Basenpaare strickleiterartig angeordnet sind (5` -> 3' oder 3` -> 5') am 5' Ende befindet sich Phosphat am 3' Ende befindet sich eine OH-Gruppe -> unterschiedliche Enden geben der DNA ihre Orientierung - Struktur einer Doppelhelix - Wasserstoffbrückenbindung zwischen den übereinanderliegenden aromatischen Ringen der Basen (= Stapelkräfte) -> stabilisieren die Raumstruktur -> verknüpfen die Basen (Adenin&Thymin=2, Gunanin&Cytosin=3) - TA-Stapel weniger Stabil (wegen fehlender Aminogruppe bei Thymin) höherer CG-Gehalt = größere Stabilität - die Abfolge der Basen codiert die Erbinformation DNA Verpackung DNA ↓↓ Nucleosomen ↓ Filament ↓ Rosette ↓ Chromatid ↓ Chromosom Rosette Aufgaben der DNA Speicherung der Erbinformationen - Weitergabe der Erbinformationen - Steuerung der Lebensvorgänge - NNN Chromosome Chromatid Filament = Adenin Thymin Cytosin Histones = = Guanin Phosphat- =...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen


Schule. Endlich einfach.

App öffnen

Alternativer Bildtext:

desoxyribose Strang Eine Gruppe von Proteinen, die wie ,,Lockenwickler" wirken. Dadurch entstehen Nucleosome Nucleosome DNA helix ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT