Biologie /

Genetischer Code

Genetischer Code

user profile picture

study.alea

2928 Followers
 

Biologie

 

11/12/13

Ausarbeitung

Genetischer Code

 3
GENETISCHER CODE
Val
Arg
Ser
Ala
Lys
له
Cu
Asp
Asn
GA
GA
Cu
BEISPIEL:
Glu
Thr
mRNA:
C
U
G
mRNA:
A
GA
Met
Start
Gly Phe Leu
UA
UA
C G C G

Kommentare (6)

Teilen

Speichern

123

Code-Sonne

Nichts passendes dabei? Erkunde andere Fachbereiche.

3 GENETISCHER CODE Val Arg Ser Ala Lys له Cu Asp Asn GA GA Cu BEISPIEL: Glu Thr mRNA: C U G mRNA: A GA Met Start Gly Phe Leu UA UA C G C G A GUC CUG GA C lle ات A GUG ACU A A Arg A C Ser 104 G UC Gln SOROS Tyr His A G Uc UC AG Stop Pro Stop Cys Stop Trp codogener Strang: 3'CTGGCTACTGACC C G C T T C T T C T A T C 5' Leu 5 ' G A C C G A U G A C U G G G C G AAGAA GAUAG 3' Met Thr Gly Arg Arg Arg Stopp nicht codogener Strang 3'CTGGCTACTGACCCCCTTCTTCTATO 5' 3° 5' CUGGCUA CUIGA CICCGCUUKUUICU AVC 3' Leu Ala Thr Asp Pro Lev Lev CODESONNE komplementäre Basen (Uracil statt Thymin) Uracil statt Thymin) TRIPLETT-CODE: als RNA-Sequenz in 5'-3-Richtung angegeben UNIVERSELL: gilt für fast alle Lebewesen EINDEUTIG: jedes Triplett und jedes Codon codiert nur eine Aminosäure DEGENERIERT: fast alle Aminosäuren werden durch mehrere Tripletts codiert KOMMAFREI: Codons schließen lückenlos aneinander NICHT ÜBERLAPPEND: eine Base ist immer nur Bestandteil eines Codons

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Biologie /

Genetischer Code

Genetischer Code

user profile picture

study.alea

2928 Followers
 

Biologie

 

11/12/13

Ausarbeitung

Genetischer Code

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 3
GENETISCHER CODE
Val
Arg
Ser
Ala
Lys
له
Cu
Asp
Asn
GA
GA
Cu
BEISPIEL:
Glu
Thr
mRNA:
C
U
G
mRNA:
A
GA
Met
Start
Gly Phe Leu
UA
UA
C G C G

App öffnen

Teilen

Speichern

123

Kommentare (6)

Y

Cool, mit dem Lernzettel konnte ich mich richtig gut auf meine Klassenarbeit vorbereiten. Danke 👍👍

Code-Sonne

Ähnliche Knows

1

Der genetische Code

Know Der genetische Code thumbnail

117

 

11/12/10

Der genetische Code

Know Der genetische Code  thumbnail

55

 

11

Proteinbiosynthese und genetischer Code

Know Proteinbiosynthese und genetischer Code thumbnail

605

 

11/12/10

8

Proteinbiosynthese (Translation, Transkription), Genmutation

Know Proteinbiosynthese (Translation, Transkription), Genmutation thumbnail

120

 

11/12/13

Mehr

3 GENETISCHER CODE Val Arg Ser Ala Lys له Cu Asp Asn GA GA Cu BEISPIEL: Glu Thr mRNA: C U G mRNA: A GA Met Start Gly Phe Leu UA UA C G C G A GUC CUG GA C lle ات A GUG ACU A A Arg A C Ser 104 G UC Gln SOROS Tyr His A G Uc UC AG Stop Pro Stop Cys Stop Trp codogener Strang: 3'CTGGCTACTGACC C G C T T C T T C T A T C 5' Leu 5 ' G A C C G A U G A C U G G G C G AAGAA GAUAG 3' Met Thr Gly Arg Arg Arg Stopp nicht codogener Strang 3'CTGGCTACTGACCCCCTTCTTCTATO 5' 3° 5' CUGGCUA CUIGA CICCGCUUKUUICU AVC 3' Leu Ala Thr Asp Pro Lev Lev CODESONNE komplementäre Basen (Uracil statt Thymin) Uracil statt Thymin) TRIPLETT-CODE: als RNA-Sequenz in 5'-3-Richtung angegeben UNIVERSELL: gilt für fast alle Lebewesen EINDEUTIG: jedes Triplett und jedes Codon codiert nur eine Aminosäure DEGENERIERT: fast alle Aminosäuren werden durch mehrere Tripletts codiert KOMMAFREI: Codons schließen lückenlos aneinander NICHT ÜBERLAPPEND: eine Base ist immer nur Bestandteil eines Codons

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen