Biologie /

Proteinbiosynthese

Proteinbiosynthese

 Transkription:
umschreiben der Erbinformationen in der DNA in Form einer einzelsträngigen RNA --> mRNA (Kopie
wird hergestellt)
Wichtig, da

Proteinbiosynthese

L

Leonie

42 Followers

Teilen

Speichern

48

 

11/12

Lernzettel

Transkription und Translation sowie der Unterschied zwischen Pro- und Eukaryoten bei der Biosynthese erklärt

Nichts passendes dabei? Erkunde andere Fachbereiche.

Transkription: umschreiben der Erbinformationen in der DNA in Form einer einzelsträngigen RNA --> mRNA (Kopie wird hergestellt) Wichtig, damit die DNA geschützt im Zellkern bleiben kann und falls die Kopie beim Transport „kaputt geht immer noch das Original besteht Drei Abschnitte: Initiation: - genetische Informationen werden auf die mobile RNA übertragen - RNA Polymerase bindet an eine spezifische DNA Sequenz, dem Promotor DNA Doppelhelix wird entwunden der codogene Strang wird von 3' nach 5' abgelesen Elongation: RNA Polymerase liest Nukleotide ab - Nukleotide werden mit den komplementären Basen herangeführt und zur mRNA verbunden DNA wird hinter der Polymerase verschlossen und gewunden - Proteinbiosynthese Weg vom Gen zum Protein, wobei die hergestellten Proteine unser Erscheinungsbild und unseren Stoffwechsel beeinflussen Termination: Terminator Sequenz wird abgelesen RNA Strang wird freigesetzt RNA Polymerase löst sich -> mRNA Einzelstrang - - - Unterschied DNA & mRNA: DNA 4.Base: Thymin Desoxyribose unbeweglich länger mRNA 4. Base: Uracil Ribose beweglich kürzer doppelsträngig einsträngig langlebig kurzlebig f KLAID Antisense strand RNA polymerase CIGACGGAICAGCCGCAAG GGAATT&GEGA CATAA. GACUG CCU AGUCGGCGUU RNA Transcript GALTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT Sense Strand Translation: übersetzen des genetischen Codes in unserem Zellplasma und den Ribosomen Ablesen findet durch unsere Ribosomen und die tRNA statt Ribosomen besitzen drei Anbindungsstellen: A-Stelle (Aminoacyl-Stelle); P-Stelle (Polypeptid-Stelle); E-Stelle (Exit-Stelle) Drei Abschnitte: Initiation: mRNA bindet an das Ribosom Ribosom erkennt ein Startcodon und führt die passende tRNA an die P Stelle weiteres tRNA Molekül mit komplementärem Anticodon lagert sich an die A Stelle an - Ribosom wandert in 3'Richtung Elongation: - Ribosom wandert immer ein Triplett weiter - leeren tRNA Moleküle rutschen an die E Stelle...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

und lösen sich - neue tRNA Moleküle mit Aminosäuren binden am Ribosom (A Stelle) passend für bestimmte Codone - Enzyme katalysieren bei jedem Triplett die Bindung der Aminosäuren an der P Stelle - Polypeptidkette entsteht Termination: Stopcodone haben kein tRNA Molekül mit passender Aminosäure Ribosom zerfällt & gibt Polypeptid frei -> Polypeptid bzw. Protein wurde synthetisiert neu synthetisiertes Protein tRNA mRNA Aminosäuren Gen große Unter- einheit A-Stelle P-Stelle Protein biosynthese Herstellung von Enzym Primar-, Sekundär, Transkription Translation DNA mRNA. Struktur. Proteine Tertiär, Quortar- (Nucleotidsequenz) (Nucleati sequenz) (Aminosäure sequenz) im lellkern im/am Ribosom kleine Untereinheit Reaktion .mit. Substrat Phän Unterschied: Proteinbiosynthese bei Eukaryoten und Prokaryoten Eukaryoten einzelne Schritte sind räumlich voneinander getrennt (Transkription: Zellkern; Translation: Cytoplasma am rauen ER) Modifizierung der RNA, sodass sie länger haltbar, vor dem Abbau durch Enzyme geschützt ist und die nicht codierten Bereiche (Introns) herausgeschnitten werden • mRNA ist länger als bei Prokaryoten (länger als benötigt -> nur Exons tragen die Informationen für die Proteine -> Introns werden herausgeschnitten und Exons verbunden (Spleißen) beim Spleißen können unterschiedliche Exons kombiniert werden -> es entstehen versch. mRNAs und durch ein gleiches Gen können versch. Proteine codiert werden Prokaryoten gesamter Ablauf findet im Cytoplasma statt, da es keinen Zellkern gibt • keine Modifizierung ● fehlen die Enzyme für das Spleißen

Biologie /

Proteinbiosynthese

L

Leonie  

Follow

42 Followers

 Transkription:
umschreiben der Erbinformationen in der DNA in Form einer einzelsträngigen RNA --> mRNA (Kopie
wird hergestellt)
Wichtig, da

App öffnen

Transkription und Translation sowie der Unterschied zwischen Pro- und Eukaryoten bei der Biosynthese erklärt

Ähnliche Knows

user profile picture

Die Proteinbiosynthese/Eiweißsynthese

Know Die Proteinbiosynthese/Eiweißsynthese thumbnail

16

 

11/12/13

user profile picture

Proteinbiosynthese, Transkription, Translation & mehr

Know Proteinbiosynthese, Transkription, Translation & mehr  thumbnail

11

 

12

user profile picture

10

Zusammenfassung Genetik Abi

Know Zusammenfassung Genetik Abi thumbnail

248

 

11/12/13

user profile picture

9

Molekulargenetik

Know Molekulargenetik  thumbnail

8

 

11/12/10

Transkription: umschreiben der Erbinformationen in der DNA in Form einer einzelsträngigen RNA --> mRNA (Kopie wird hergestellt) Wichtig, damit die DNA geschützt im Zellkern bleiben kann und falls die Kopie beim Transport „kaputt geht immer noch das Original besteht Drei Abschnitte: Initiation: - genetische Informationen werden auf die mobile RNA übertragen - RNA Polymerase bindet an eine spezifische DNA Sequenz, dem Promotor DNA Doppelhelix wird entwunden der codogene Strang wird von 3' nach 5' abgelesen Elongation: RNA Polymerase liest Nukleotide ab - Nukleotide werden mit den komplementären Basen herangeführt und zur mRNA verbunden DNA wird hinter der Polymerase verschlossen und gewunden - Proteinbiosynthese Weg vom Gen zum Protein, wobei die hergestellten Proteine unser Erscheinungsbild und unseren Stoffwechsel beeinflussen Termination: Terminator Sequenz wird abgelesen RNA Strang wird freigesetzt RNA Polymerase löst sich -> mRNA Einzelstrang - - - Unterschied DNA & mRNA: DNA 4.Base: Thymin Desoxyribose unbeweglich länger mRNA 4. Base: Uracil Ribose beweglich kürzer doppelsträngig einsträngig langlebig kurzlebig f KLAID Antisense strand RNA polymerase CIGACGGAICAGCCGCAAG GGAATT&GEGA CATAA. GACUG CCU AGUCGGCGUU RNA Transcript GALTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT Sense Strand Translation: übersetzen des genetischen Codes in unserem Zellplasma und den Ribosomen Ablesen findet durch unsere Ribosomen und die tRNA statt Ribosomen besitzen drei Anbindungsstellen: A-Stelle (Aminoacyl-Stelle); P-Stelle (Polypeptid-Stelle); E-Stelle (Exit-Stelle) Drei Abschnitte: Initiation: mRNA bindet an das Ribosom Ribosom erkennt ein Startcodon und führt die passende tRNA an die P Stelle weiteres tRNA Molekül mit komplementärem Anticodon lagert sich an die A Stelle an - Ribosom wandert in 3'Richtung Elongation: - Ribosom wandert immer ein Triplett weiter - leeren tRNA Moleküle rutschen an die E Stelle...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich einfach.

App öffnen

Alternativer Bildtext:

und lösen sich - neue tRNA Moleküle mit Aminosäuren binden am Ribosom (A Stelle) passend für bestimmte Codone - Enzyme katalysieren bei jedem Triplett die Bindung der Aminosäuren an der P Stelle - Polypeptidkette entsteht Termination: Stopcodone haben kein tRNA Molekül mit passender Aminosäure Ribosom zerfällt & gibt Polypeptid frei -> Polypeptid bzw. Protein wurde synthetisiert neu synthetisiertes Protein tRNA mRNA Aminosäuren Gen große Unter- einheit A-Stelle P-Stelle Protein biosynthese Herstellung von Enzym Primar-, Sekundär, Transkription Translation DNA mRNA. Struktur. Proteine Tertiär, Quortar- (Nucleotidsequenz) (Nucleati sequenz) (Aminosäure sequenz) im lellkern im/am Ribosom kleine Untereinheit Reaktion .mit. Substrat Phän Unterschied: Proteinbiosynthese bei Eukaryoten und Prokaryoten Eukaryoten einzelne Schritte sind räumlich voneinander getrennt (Transkription: Zellkern; Translation: Cytoplasma am rauen ER) Modifizierung der RNA, sodass sie länger haltbar, vor dem Abbau durch Enzyme geschützt ist und die nicht codierten Bereiche (Introns) herausgeschnitten werden • mRNA ist länger als bei Prokaryoten (länger als benötigt -> nur Exons tragen die Informationen für die Proteine -> Introns werden herausgeschnitten und Exons verbunden (Spleißen) beim Spleißen können unterschiedliche Exons kombiniert werden -> es entstehen versch. mRNAs und durch ein gleiches Gen können versch. Proteine codiert werden Prokaryoten gesamter Ablauf findet im Cytoplasma statt, da es keinen Zellkern gibt • keine Modifizierung ● fehlen die Enzyme für das Spleißen