Biologie /

Genetik/Proteinbiosynthese

Genetik/Proteinbiosynthese

user profile picture

johanna

393 Followers
 

Biologie

 

11/12

Klausur

Genetik/Proteinbiosynthese

 Bio Q1 GK
Aufgabe 1
Der Schüler/ Die Schülerin...
beschriftet die Markierungen:
A Ribosom
B beladene tRNA
C mRNA
D entladene tRNA
E Aminosä
 Bio Q1 GK
Aufgabe 1
Der Schüler/ Die Schülerin...
beschriftet die Markierungen:
A Ribosom
B beladene tRNA
C mRNA
D entladene tRNA
E Aminosä
 Bio Q1 GK
Aufgabe 1
Der Schüler/ Die Schülerin...
beschriftet die Markierungen:
A Ribosom
B beladene tRNA
C mRNA
D entladene tRNA
E Aminosä

Kommentare (3)

Teilen

Speichern

460

Hier meine Klausur aus Biologie über Genetik/Proteinbiosynthese. In der Klausur hatte ich 10 Punkte (2-).

Nichts passendes dabei? Erkunde andere Fachbereiche.

Bio Q1 GK Aufgabe 1 Der Schüler/ Die Schülerin... beschriftet die Markierungen: A Ribosom B beladene tRNA C mRNA D entladene tRNA E Aminosäurekette/ Protein 2. Klausur Genetik Name: benennt den dargestellten Vorgang als Translation. beschreibt diesen: Translation ist zweite Phase der Proteinbiosynthese und findet im Cytoplasma statt. Die mRNA wird hier in ein Protein/ eine Aminosäurekette übersetzt. Erwartungshorizont Die beiden Untereinheiten des Ribosoms schließen sich am Start-Codon der mRNA zum Ribosom zusammen. An der Anbindungsstelle verbindet sich das Anticodon der beladenen tRNA mit dem entsprechenden Codon der mRNA. ✓ Wenn das Ribosom beim Ablesen der mRNA eine Stelle weiterrückt, gelangt die tRNA von der Anbindungsstelle an die Mittelstelle. Dort werden die Aminosäuren mit den vorherigen Aminosäuren verbunden. Durch die Aneinanderreihung der Aminosäuren entsteht ein Protein. Aufgabe 2 Der Schüler/ Die Schülerin... Die entladene tRNA rückt auf die Abgangsstelle, von wo aus sie das Ribosom verlässt. Das Ribosom wandert auf der mRNA vom 5' Ende bis zum 3' Ende, bis es zu einem Stopp Codon gelangt. Der Komplex zerfällt und die Translation ist ") beendet. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). Summe 1 (1)... beschreibt den Prozess der RNA-Prozessierung: f Teil der Genexpression Ort ist der Zellkern; nach Prozessierung verlässt reife mRNA den Zellkern ✓ Findet nur bei Eukaryoten statt Besteht aus Spleißen und dem Ansetzen einer „Kappe" (Cap) am 5'- Ende und eines „Schwanzes" am 3'- Ende. (V) Spleißen: DNA und prä-mRNA enthalten Zwischenstücke, die keine genetischen Informationen tragen...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

(Introns) und codierende Abschnitte (Exons); Introns werden herausgeschnitten. ✓ Funktion Spleißen: reife mRNA wird gebildet ✓ 1 AFB/ Pkt. \/|| 21/24 AFB/ Pkt. | Bio Q1 GK Funktion „Kappe" und „Schwanz": Verzögerung des Abbaus der mRNA im Cytoplasma (v) Aufgabe 3 Der Schüler/ Die Schülerin ... (2)... erklärt die Entstehung der unterschiedlichen mRNAS: mRNA für Lamin A enthält Exons 9, 10a, 11 und 12, in mRNA für Lamin C fehlen die Exons 11 und 12, dafür ist zusätzlich Exon 10b vorhanden; Prozessierung der reifen mRNA aus prä-mRNA: Herausschneiden von Introns und unterschiedlichen Exons durch alternatives Spleißen; verbliebene Exons werden zur mRNA verknüpft; Mosaikgen → unterschiedliche mRNAs unterschiedliche Proteine. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). Summe 2 (1) ... ... leitet unter Angabe aller Schritte die Aminosäuresequenz ab: Lamin A 5'... GTC CAC CCG CCT GGG 3' 5'... CAG GUG GGC GGA CCC ... 3' - Gin-Val-Gly-Gly-Pro- codogener Strang mRNA 2. Klausur Genetik Aminosäuresequenz Progerin 5'... GTC CAC CCA CCT GGG 3' 5'... CAG GUG GGU GGA CCC ... 3' - Gin-Val-Gly-Gly-Pro- Aminosäuresequenz (2) ... begründet, um welche Art von Mutation es sich handelt: codogener Strang mRNA f () Insertion: Basen sind eingefügt Deletion: Basen sind ausgefallen (U) f DNA-Sequenz von Progerin weist im Vergleich zur DNA-Sequenz von Lamin A eine veränderte Base in Exon 11 auf: T statt C Trotz Basensubstitution (Punktmutation) wird gleiche Aminosäure codiert stumme Mutation. Erwartungshorizont (3)... begründet, warum man zunächst nicht davon ausgehen konnte, dass eine Mutation dafür verantwortlich ist: Duplikation: Basen sind verdoppelt erklärt, warum viele Mutationen das Protein nicht verändern: Viele Mutationen finden auf den Introns statt. Da diese beim Spleißen, herausgeschnitten werden, hat das keinen Einfluss auf das Protein. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). n (v) 2 9/12 |\/||| 4A/12 ||| 20/24 AFB/ Pkt. || 4112 || Bei stummer Mutation kommt es zu keinem Aminosäurenaustausch →→ keine Auswirkungen auf das sich bildende Protein und damit auf den Phänotyp zu erwarten; Erkrankungszeichen sind allerdings phänotypische Veränderungen. 516 (4)... nennt drei weitere Formen von Mutationen und beschreibt diese: I/II z.B. 9/10 416 Bio Q1 GKnuhswi3 Summe 3 1 19 Aufgabe 4 Der Schüler/ Die Schülerin ... 2. Klausur Genetik Aufgabe 5 Der Schüler/ Die Schülerin... erklärt, wie es zu der Veränderung des Proteins kommt: In Progerin-mRNA fehlt ein Abschnitt des Exons 11, es wird ein kürzeres Protein gebildet; z.B. dadurch erklärbar, dass durch Basensubstitution neue Schnittstelle für Spleißen entstanden ist. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). Summe 4 Erwartungshorizont (1).. beschreibt die Wirkung von Progerin auf zellulärer Ebene: Lamin A und Lamin C bilden nach der Aufnahme in den Zellkern an der Innenseite der Kernmembran polymerisierte Fadenstrukturen, die dafür sorgen, dass der Zellkern seine Form bewahrt; Progerin kann im Zellkern keine stabile Polymerfäden bilden, sondern ist ungeordnet verteilt → Zellkerne. Deformierung der (2)...entwickelt eine Hypothese: Progerin führt zu einer instabilen Kernmembran, was genetische Fehlfunktionen und damit das frühe Absterben der Zellen verursacht; da Lamin A vorwiegend in Zellen der Haut, der Knochen und der Gefäßwände exprimiert wird, kommt es phänotypisch zur rapiden Alterung gerade dieser Gewebetypen. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). Summe 5 3 22/34 AFB/ Pkt. 516 AFB/ Pkt. || A 16 ||| 216 3/12 Bio Q1 GK Darstellungsleistung Führt den Gedanken schlüssig, stringent und klar aus. Strukturiert die Darstellung sachgerecht. ^ Verwendet eine differenzierte und präzise Sprache. 3 Veranschaulicht die Ausführungen durch geeignete Skizzen, Schemata etc. Gestaltet seine Arbeit formal ansprechend. ✔ Summe Darstellungsleistung Summe inhaltliche Leistung Summe Gesamt Die Klausur wird abschließend mit der Notegut minus Note Gesamtnote: Notenpunkte) ggf. Absenkung der Note um ein bis zwei Notenpunkte gemäß § 13 Abs. 2 APO-GOST (grobe Verstöße gegen die deutsche Sprache) sehr gut plus sehr gut sehr gut minus gut plus gut Grundsätze für die Bewertung (Notenfindung) Für die Zuordnung der Notenstufen zu den Punktzahlen ist die folgende Tabelle zu verwenden: gut minus befriedigend plus befriedigend befriedigend minus ausreichend plus ausreichend ausreichend minus mangelhaft plus mangelhaft mangelhaft minus ungenügend Punkte 15 14 13. 12 11 10 9 8 7 6 5 4 2. Klausur Genetik 3 2 1 0 (Notenpunkte) bewertet. Erreichte Punktzahl 120-114 113-108 107-102 101-96 95-90 89-84 83-78 77-72 71-66 65-60 59-54 53-47 46-39 38-31 Erwartungshorizont 17.01.21 31-24 23-0 Pkt. 461 20 A/100 871120 Datum, Unterschrift GK Q1 Biologic Name: Progerie - zu jung zum Altern Alterungserscheinungen bei an Progerie erkranktem Kind Klausur Nr.2 12.01.2021 Eigentlich sind es ganz normale Kinder, die spielen, lachen und die gleichen Bedürfnisse haben wie ihre Altersgenossen. Eines fällt jedoch auf: Der Alterungsprozess der weltweit nur etwa 200 bis 250 an Progerie erkrankten Kinder verläuft fünf- bis zehnmal schneller als bei gesunden Menschen. So leiden die betroffenen Kinder schon ab dem ersten Lebensjahr an Wachstumsstörungen, ihre Haut altert schneller, mit den Jahren kommen Haarausfall, Arterienverkalkung (Arteriosklerose), Gelenkverschleiß (Arthrose) und Knochenschwund (Osteoporose) hinzu. Herzinfarkt oder Schlaganfall als Folge einer Arteriosklerose führen zu einem sehr frühen Tod, im Schnitt mit bereits 13 Jahren. Bei den Kindern lässt sich eine Deformation eines großen Teils der Zellkerne feststellen. Inzwischen weiß man, dass eine Mutation im Lamin- Gen zu veränderten Strukturproteinen führt, die für diese Zellschädigung verantwortlich sind und die Vergreisung bereits im Kindesalter verursacht. Aufgaben: Beschriften Sie die Bestandteile (A - E) in Material 1 mit den entsprechenden Fachbegriffen. Benennen Sie den dargestellten Vorgang und beschreiben Sie diesen. (24 Pkt.) (Beschreiben Sie den Prozess der RNA-Prozessierung. Beziehen Sie dabei auch die Funktionen dieses Prozesses mit ein. (12 Pkt.) (2) Erklären Sie mithilfe von Material 2 die Entstehung der beiden unterschiedlichen mRNAs aus der prä-mRNA für die Proteine Lamin A und C. (12 Pkt.) Leiten Sie ausgehend von Material 3 unter Angabe aller Schritte die Aminosäuresequenz der entsprechenden Abschnitte für Lamin A und das mutierte Lamin A (Progerin) ab. (12 Pkt.). Begründen Sie, um welchen Typ von Mutation es sich handelt. (6 Pkt.) Begründen Sie, warum die Wissenschaftler hier zunächst nicht davon ausgehen konnten, dass diese Mutation für das Krankheitsbild der Progerie verantwortlich ist. (6 Pkt.) (24) Nennen Sie drei weitere Formen von Mutationen und beschreiben Sie diese. Erklären Sie, warum viele Mutationen keinen Einfluss auf das Protein haben. (10 Pkt.) Erklären Sie unter Einbezug von Material 4, wie es doch zu einer Veränderung des Proteins kommt. (6 Pkt.) 5 (1) Beschreiben Sie die Wirkung von Progerin auf zellulärer Ebene (Material 5). (6 Pkt.) (2) Entwickeln Sie materialgestützt eine Hypothese für den vorzeitigen Alterungsprozess von Progerie-Patienten. (6 Pkt.) Material 1: Phase der Proteinbiosynthese D Gna START 5' START START Met UGGEGUAL FF START Met Pro START UACGG AUGEEGUA ES UAGGGO Pro AUGESGUAUCA Met Pro Met GG AUA AUGEEGUAU AUCA Leu 111 GAA UUUAA GUA STOP A Tyr 2 Pro -B Tyr His fr GUG His His Tyr Pro Tyr His Met STOP ***** STOP STOP STOP E 1 Material 2: Das Lamin-Gen Das Lamin-Gen besteht aus 12 Exons und codiert für zwei Proteine, Lamin A und Lamin C. Die Abbildung zeigt schematisch einen Ausschnitt aus dem Lamin-Gen im Bereich der Exons 9 bis 12 sowie den daraus folgenden Aufbau der für die beiden Proteine Lamin A bzw. C codierenden mRNAs. DNA mRNA für Lamin-A-Protein mRNA für Lamin-C-Protein Exon 9 3' Val Exon 9 Arg Ala Ser Exon 9 Exon 10 Ausschnitt aus dem Lamin-Gen und Aufbau der mRNAs von Lamin A bzw. C Triplett-Nr. im Gen Lamin-Gen mutiertes Lamin-Gen Ausschnitt aus dem Exon 11 (Code-Strang) des Lamin-Gens Lys G Material 3: Genmutation im Lamin-Gen Vom Protein Lamin A tritt bei an Progerie erkrankten Personen ein Variante auf, die auf eine Genmutation im Lamin-Gen zurückzuführen ist: das Protein Progerin. Die Tabelle zeigt den Ausschnitt aus dem Exon 11 (Code-Strang) des Lamin-Gens dieser beiden Varianten. C U G A C U Exon 10 Asp G Asn Glu C U Exon 10 EXON G A Thr A Gly GUCAGUCAGUCAGUCAGUCA GU Start Met 106 vilwichlig Exon 11 G A 606 607 608 609 610 5' CAG GTG GGC GGA CCC ... 3' 5'... CAG GTG GGT GGA CCC ... 3' 3' lle Phe Leu 5' C YONGACUGACUGA U UG C 3' 11 & 12 unwichtig 3 Arg Codesonne zur Übersetzung von mRNA-Tripletts in Aminosäuren Exon 11 C A GABUAR Ser A Exon 12 G C U Gin Tyr G His U ASUGA C A G C A G U Stopp Stopp Cys Pro Stopp Trp Leu Exon 12 3' Material 4: Auswirkungen der Punktmutation im Lamin-Gen Die Progerie verursachende Punktmutation liegt in Triplett 608 des Lamin-Gens. In der folgenden Abbildung ist zu sehen, dass eine neue Spleißstelle entstanden ist. gesunder Mensch DNA mRNA Inplett 400 Exon 11 Exon 11 Zellkern Protein Lamin-A Exon 12 Exon 12 Bereich, der durch das Spleißen herausgeschnitten wird Durch Punktmutation entstandene neue Spleißstelle im Lamin-Gen Lamin-C Lamin-A Progerin Lamin-C Exon 11 Einfluss von Progerin auf die Struktur der Kernmembran 505 Material 5: Veränderungen an der Kernmembran durch Progerin Lamin A wird vorwiegend in Zellen der Haut, der Knochen und der Gefäßwände exprimiert. Es bildet zusammen mit dem ebenfalls gebildeten Lamin C nach der Aufnahme in den Zellkern an der Innenseite der Kernmembran polymerisierte Fadenstrukturen, die dafür sorgen, dass der Zellkern seine Form bewahrt. Cytoplasma Progerie-Patient näitte Exon 11 Exon 12 Protein Progerin Exon 12 Cytoplasma -innere Kernmembran Aufgabe B- C- D- E Bio Klausur Diese dann mit 1: Bei der abgebildeten phase der Protein basynthese Translation gezeigt. wird die Bei der zuerst Translation fügen sich Untereinheiten dil des Ribosoms +mRyg einem funktions- fånigem Ribosom zusammen, was Sich dann an die mRNA an- Ribosom ist ein Enzymkomplex und somit nur in lagert. Das 3' → 5' Richtung An der drei Som, die Bindungsstellen mit dem Anfangs-, Mittel- und Abgangsstelle. Im Cytoplasma werden ERNA · Molekule Aminosäure beladen. Ribasom ebeladene tRNA Nr. 2 mRNA entladene tRNA Aminosäure kette ✓ an der ablesbar. Das Ribosom wild nicht MRNA binden sich bilden sich dann abgeleren Ribo- Anticodons der MRNA. Wenn mit einer verbinden sich Anfangsstelle das 12.01.21 der ROA -^- Es ist doch Schon ander mRuA Ribosom dann auf der MBIVA ein Stück weiterrückt gelange das MRIVA, wo die die Enzymen Aminosäure- wird! Die nun dann an -2- Anticodon an Aminosaure mit Hilfe von vorhergehende an die kette angebunden entladene ERNA die Abgangsstelle mRNA entladene ERNA der plasma ist, wird einer nimmt ES gelangt und abgestoßen. wieder Sie SO Translation teil. Aminosäure beladen und wieder schnell an der kommt 20m Translation, wenn (derm BWA Stopp- codon erreicht, da es das Stopp-codon ERIVA gibt. Beim Translation Lost * bildet wird van Sobald die im Cyto wieder mit Abbruch das Ribosom das aus Ribosom Die entstandene Aminosäurekette Nach Beendigung der ist das Protein in عله für passende keine Abbruch der Lost sich der und der komplex MRNA. * das Protein. Translation seiner Primar- Struktur nach Vorgaben nach Vorgaben der DNA entstanden. ✓ Bei der aus der erstellt. Außerdem bei Dieser Vorgang kommt nur Eukaryoten vor und muss Ge- schehen, da die durch die pră-MRIVA nur RNA- Prozessierung zur mRNA reift. Die RNA- Prozessierung besteht aus •Spleißen ± 5' kappe und 3' Schwanz. ganzer Satz t Die introns, also MRNA Abschnitte, die keine genetische information RNA- Prozessierung wird pra-mRNA die MRNA enthalten werden transkribiert, nehmen aber nicht an dir Translation verzögert sie den Abbaute Vorgang der RNA-Drozessieruly) zwischen Transkription und Transe lation statt. Querst wird am pra-mRNA eine teil, somit findet der Das Teile abgewandelten Nucleotiden gesetzt", die die RNA Abbau Schutzt. An das wird عله S' Ende der Kappe aus gehängt, der aus bestent ✓ auf- иск ает ein Poly - A-Schwanz ain- vielen Adeninen 3 Ende Erst Spleißen ungen Splicing Schneidet unwichtige dans Kappe (Schwam pra-mRNA, also die Introns, welche aus Luclectiden be- * der mRNA. was genau? -3- - نا- stenen aus der pră-mRNA unol fügt die Exons, also die Abschnitte die genetische informationen enthalten wieder zusammen. So entstent die MRNA, die nur aus Exons stent. be- Das Lamin-Gen cocliert für zwei Proteine Lamin A und lamin C. и Aus der prä-mRNA für das Cam A- Protein wird das stein wird das Excn 10b neben den introns es aus der MRINA für die Bildung Lamin-A - Proteins nicht wichtig geschnitten, da des ist. V Bei der pra - MRIVA des lamin-C- Proteins werden neben den introns поси Excn 11 und EXON 12 das das herausgeschnitten, da dife nicht wichtig sind und keine weiterer Einflüsse auf die Bildung des lamin- C- Proteins haben. ✓ (3) Lamin-Gen MRNA mutiertes (amin Gen mRNA CAG GUC val CAG GUC val GTG CAC HIS GTG CAC His GGC GGA CCC Das ist der (tode Strang CCG CCU GGG f Pro Pro Gly (0) Folgefehler GGT GGA CCA CCU Pro Pro CCC GGG f Gly (V) Folgefehler f C Bei dem lamin - Gen, welches mutiest ist handelt es sich um eine Slille Mutation, welche eine Punkt- mutation ist und auf die ist und keine Auswirkungen Aminosäure sequenz hat. Außerdem handelt es sich um eine Selection f das heißt, eine Base ist Vertauscht. Z Was ist denn ausgetauscht. Genauer beschreiben Mutation Wissenschaftler sind vorerst nicht davon ausgegangen, dass diese für die Drogerie (nicht) verantwortlich ist, da die Stille Mutation, um um die es sich handelt, keine Auswirkungen auf die Aminosauresequenz haben hat die gleichen und somit trotzdem Aminosäuren codiert werden. bzw. das glache Prokin entsteht Bezugus Phänotyp. ero -5-

Biologie /

Genetik/Proteinbiosynthese

Genetik/Proteinbiosynthese

user profile picture

johanna

393 Followers
 

Biologie

 

11/12

Klausur

Genetik/Proteinbiosynthese

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 Bio Q1 GK
Aufgabe 1
Der Schüler/ Die Schülerin...
beschriftet die Markierungen:
A Ribosom
B beladene tRNA
C mRNA
D entladene tRNA
E Aminosä

App öffnen

Teilen

Speichern

460

Kommentare (3)

Z

So ein schöner Lernzettel 😍😍 super nützlich und hilfreich!

Hier meine Klausur aus Biologie über Genetik/Proteinbiosynthese. In der Klausur hatte ich 10 Punkte (2-).

Ähnliche Knows

13

Genetik: Proteinbiosynthese, Genetischer Code, Mutationen, Genregulation

Know Genetik: Proteinbiosynthese, Genetischer Code, Mutationen, Genregulation thumbnail

419

 

11/12/13

8

Proteinbiosynthese (Translation, Transkription), Genmutation

Know Proteinbiosynthese (Translation, Transkription), Genmutation thumbnail

1937

 

11/12/13

Genetik

Know Genetik thumbnail

2813

 

11

Die Prozessierung der RNA

Know Die Prozessierung der RNA thumbnail

1064

 

11/12/10

Mehr

Bio Q1 GK Aufgabe 1 Der Schüler/ Die Schülerin... beschriftet die Markierungen: A Ribosom B beladene tRNA C mRNA D entladene tRNA E Aminosäurekette/ Protein 2. Klausur Genetik Name: benennt den dargestellten Vorgang als Translation. beschreibt diesen: Translation ist zweite Phase der Proteinbiosynthese und findet im Cytoplasma statt. Die mRNA wird hier in ein Protein/ eine Aminosäurekette übersetzt. Erwartungshorizont Die beiden Untereinheiten des Ribosoms schließen sich am Start-Codon der mRNA zum Ribosom zusammen. An der Anbindungsstelle verbindet sich das Anticodon der beladenen tRNA mit dem entsprechenden Codon der mRNA. ✓ Wenn das Ribosom beim Ablesen der mRNA eine Stelle weiterrückt, gelangt die tRNA von der Anbindungsstelle an die Mittelstelle. Dort werden die Aminosäuren mit den vorherigen Aminosäuren verbunden. Durch die Aneinanderreihung der Aminosäuren entsteht ein Protein. Aufgabe 2 Der Schüler/ Die Schülerin... Die entladene tRNA rückt auf die Abgangsstelle, von wo aus sie das Ribosom verlässt. Das Ribosom wandert auf der mRNA vom 5' Ende bis zum 3' Ende, bis es zu einem Stopp Codon gelangt. Der Komplex zerfällt und die Translation ist ") beendet. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). Summe 1 (1)... beschreibt den Prozess der RNA-Prozessierung: f Teil der Genexpression Ort ist der Zellkern; nach Prozessierung verlässt reife mRNA den Zellkern ✓ Findet nur bei Eukaryoten statt Besteht aus Spleißen und dem Ansetzen einer „Kappe" (Cap) am 5'- Ende und eines „Schwanzes" am 3'- Ende. (V) Spleißen: DNA und prä-mRNA enthalten Zwischenstücke, die keine genetischen Informationen tragen...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen

Alternativer Bildtext:

(Introns) und codierende Abschnitte (Exons); Introns werden herausgeschnitten. ✓ Funktion Spleißen: reife mRNA wird gebildet ✓ 1 AFB/ Pkt. \/|| 21/24 AFB/ Pkt. | Bio Q1 GK Funktion „Kappe" und „Schwanz": Verzögerung des Abbaus der mRNA im Cytoplasma (v) Aufgabe 3 Der Schüler/ Die Schülerin ... (2)... erklärt die Entstehung der unterschiedlichen mRNAS: mRNA für Lamin A enthält Exons 9, 10a, 11 und 12, in mRNA für Lamin C fehlen die Exons 11 und 12, dafür ist zusätzlich Exon 10b vorhanden; Prozessierung der reifen mRNA aus prä-mRNA: Herausschneiden von Introns und unterschiedlichen Exons durch alternatives Spleißen; verbliebene Exons werden zur mRNA verknüpft; Mosaikgen → unterschiedliche mRNAs unterschiedliche Proteine. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). Summe 2 (1) ... ... leitet unter Angabe aller Schritte die Aminosäuresequenz ab: Lamin A 5'... GTC CAC CCG CCT GGG 3' 5'... CAG GUG GGC GGA CCC ... 3' - Gin-Val-Gly-Gly-Pro- codogener Strang mRNA 2. Klausur Genetik Aminosäuresequenz Progerin 5'... GTC CAC CCA CCT GGG 3' 5'... CAG GUG GGU GGA CCC ... 3' - Gin-Val-Gly-Gly-Pro- Aminosäuresequenz (2) ... begründet, um welche Art von Mutation es sich handelt: codogener Strang mRNA f () Insertion: Basen sind eingefügt Deletion: Basen sind ausgefallen (U) f DNA-Sequenz von Progerin weist im Vergleich zur DNA-Sequenz von Lamin A eine veränderte Base in Exon 11 auf: T statt C Trotz Basensubstitution (Punktmutation) wird gleiche Aminosäure codiert stumme Mutation. Erwartungshorizont (3)... begründet, warum man zunächst nicht davon ausgehen konnte, dass eine Mutation dafür verantwortlich ist: Duplikation: Basen sind verdoppelt erklärt, warum viele Mutationen das Protein nicht verändern: Viele Mutationen finden auf den Introns statt. Da diese beim Spleißen, herausgeschnitten werden, hat das keinen Einfluss auf das Protein. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). n (v) 2 9/12 |\/||| 4A/12 ||| 20/24 AFB/ Pkt. || 4112 || Bei stummer Mutation kommt es zu keinem Aminosäurenaustausch →→ keine Auswirkungen auf das sich bildende Protein und damit auf den Phänotyp zu erwarten; Erkrankungszeichen sind allerdings phänotypische Veränderungen. 516 (4)... nennt drei weitere Formen von Mutationen und beschreibt diese: I/II z.B. 9/10 416 Bio Q1 GKnuhswi3 Summe 3 1 19 Aufgabe 4 Der Schüler/ Die Schülerin ... 2. Klausur Genetik Aufgabe 5 Der Schüler/ Die Schülerin... erklärt, wie es zu der Veränderung des Proteins kommt: In Progerin-mRNA fehlt ein Abschnitt des Exons 11, es wird ein kürzeres Protein gebildet; z.B. dadurch erklärbar, dass durch Basensubstitution neue Schnittstelle für Spleißen entstanden ist. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). Summe 4 Erwartungshorizont (1).. beschreibt die Wirkung von Progerin auf zellulärer Ebene: Lamin A und Lamin C bilden nach der Aufnahme in den Zellkern an der Innenseite der Kernmembran polymerisierte Fadenstrukturen, die dafür sorgen, dass der Zellkern seine Form bewahrt; Progerin kann im Zellkern keine stabile Polymerfäden bilden, sondern ist ungeordnet verteilt → Zellkerne. Deformierung der (2)...entwickelt eine Hypothese: Progerin führt zu einer instabilen Kernmembran, was genetische Fehlfunktionen und damit das frühe Absterben der Zellen verursacht; da Lamin A vorwiegend in Zellen der Haut, der Knochen und der Gefäßwände exprimiert wird, kommt es phänotypisch zur rapiden Alterung gerade dieser Gewebetypen. Erfüllt ein weiteres aufgabenbezogenes Kriterium (2). Summe 5 3 22/34 AFB/ Pkt. 516 AFB/ Pkt. || A 16 ||| 216 3/12 Bio Q1 GK Darstellungsleistung Führt den Gedanken schlüssig, stringent und klar aus. Strukturiert die Darstellung sachgerecht. ^ Verwendet eine differenzierte und präzise Sprache. 3 Veranschaulicht die Ausführungen durch geeignete Skizzen, Schemata etc. Gestaltet seine Arbeit formal ansprechend. ✔ Summe Darstellungsleistung Summe inhaltliche Leistung Summe Gesamt Die Klausur wird abschließend mit der Notegut minus Note Gesamtnote: Notenpunkte) ggf. Absenkung der Note um ein bis zwei Notenpunkte gemäß § 13 Abs. 2 APO-GOST (grobe Verstöße gegen die deutsche Sprache) sehr gut plus sehr gut sehr gut minus gut plus gut Grundsätze für die Bewertung (Notenfindung) Für die Zuordnung der Notenstufen zu den Punktzahlen ist die folgende Tabelle zu verwenden: gut minus befriedigend plus befriedigend befriedigend minus ausreichend plus ausreichend ausreichend minus mangelhaft plus mangelhaft mangelhaft minus ungenügend Punkte 15 14 13. 12 11 10 9 8 7 6 5 4 2. Klausur Genetik 3 2 1 0 (Notenpunkte) bewertet. Erreichte Punktzahl 120-114 113-108 107-102 101-96 95-90 89-84 83-78 77-72 71-66 65-60 59-54 53-47 46-39 38-31 Erwartungshorizont 17.01.21 31-24 23-0 Pkt. 461 20 A/100 871120 Datum, Unterschrift GK Q1 Biologic Name: Progerie - zu jung zum Altern Alterungserscheinungen bei an Progerie erkranktem Kind Klausur Nr.2 12.01.2021 Eigentlich sind es ganz normale Kinder, die spielen, lachen und die gleichen Bedürfnisse haben wie ihre Altersgenossen. Eines fällt jedoch auf: Der Alterungsprozess der weltweit nur etwa 200 bis 250 an Progerie erkrankten Kinder verläuft fünf- bis zehnmal schneller als bei gesunden Menschen. So leiden die betroffenen Kinder schon ab dem ersten Lebensjahr an Wachstumsstörungen, ihre Haut altert schneller, mit den Jahren kommen Haarausfall, Arterienverkalkung (Arteriosklerose), Gelenkverschleiß (Arthrose) und Knochenschwund (Osteoporose) hinzu. Herzinfarkt oder Schlaganfall als Folge einer Arteriosklerose führen zu einem sehr frühen Tod, im Schnitt mit bereits 13 Jahren. Bei den Kindern lässt sich eine Deformation eines großen Teils der Zellkerne feststellen. Inzwischen weiß man, dass eine Mutation im Lamin- Gen zu veränderten Strukturproteinen führt, die für diese Zellschädigung verantwortlich sind und die Vergreisung bereits im Kindesalter verursacht. Aufgaben: Beschriften Sie die Bestandteile (A - E) in Material 1 mit den entsprechenden Fachbegriffen. Benennen Sie den dargestellten Vorgang und beschreiben Sie diesen. (24 Pkt.) (Beschreiben Sie den Prozess der RNA-Prozessierung. Beziehen Sie dabei auch die Funktionen dieses Prozesses mit ein. (12 Pkt.) (2) Erklären Sie mithilfe von Material 2 die Entstehung der beiden unterschiedlichen mRNAs aus der prä-mRNA für die Proteine Lamin A und C. (12 Pkt.) Leiten Sie ausgehend von Material 3 unter Angabe aller Schritte die Aminosäuresequenz der entsprechenden Abschnitte für Lamin A und das mutierte Lamin A (Progerin) ab. (12 Pkt.). Begründen Sie, um welchen Typ von Mutation es sich handelt. (6 Pkt.) Begründen Sie, warum die Wissenschaftler hier zunächst nicht davon ausgehen konnten, dass diese Mutation für das Krankheitsbild der Progerie verantwortlich ist. (6 Pkt.) (24) Nennen Sie drei weitere Formen von Mutationen und beschreiben Sie diese. Erklären Sie, warum viele Mutationen keinen Einfluss auf das Protein haben. (10 Pkt.) Erklären Sie unter Einbezug von Material 4, wie es doch zu einer Veränderung des Proteins kommt. (6 Pkt.) 5 (1) Beschreiben Sie die Wirkung von Progerin auf zellulärer Ebene (Material 5). (6 Pkt.) (2) Entwickeln Sie materialgestützt eine Hypothese für den vorzeitigen Alterungsprozess von Progerie-Patienten. (6 Pkt.) Material 1: Phase der Proteinbiosynthese D Gna START 5' START START Met UGGEGUAL FF START Met Pro START UACGG AUGEEGUA ES UAGGGO Pro AUGESGUAUCA Met Pro Met GG AUA AUGEEGUAU AUCA Leu 111 GAA UUUAA GUA STOP A Tyr 2 Pro -B Tyr His fr GUG His His Tyr Pro Tyr His Met STOP ***** STOP STOP STOP E 1 Material 2: Das Lamin-Gen Das Lamin-Gen besteht aus 12 Exons und codiert für zwei Proteine, Lamin A und Lamin C. Die Abbildung zeigt schematisch einen Ausschnitt aus dem Lamin-Gen im Bereich der Exons 9 bis 12 sowie den daraus folgenden Aufbau der für die beiden Proteine Lamin A bzw. C codierenden mRNAs. DNA mRNA für Lamin-A-Protein mRNA für Lamin-C-Protein Exon 9 3' Val Exon 9 Arg Ala Ser Exon 9 Exon 10 Ausschnitt aus dem Lamin-Gen und Aufbau der mRNAs von Lamin A bzw. C Triplett-Nr. im Gen Lamin-Gen mutiertes Lamin-Gen Ausschnitt aus dem Exon 11 (Code-Strang) des Lamin-Gens Lys G Material 3: Genmutation im Lamin-Gen Vom Protein Lamin A tritt bei an Progerie erkrankten Personen ein Variante auf, die auf eine Genmutation im Lamin-Gen zurückzuführen ist: das Protein Progerin. Die Tabelle zeigt den Ausschnitt aus dem Exon 11 (Code-Strang) des Lamin-Gens dieser beiden Varianten. C U G A C U Exon 10 Asp G Asn Glu C U Exon 10 EXON G A Thr A Gly GUCAGUCAGUCAGUCAGUCA GU Start Met 106 vilwichlig Exon 11 G A 606 607 608 609 610 5' CAG GTG GGC GGA CCC ... 3' 5'... CAG GTG GGT GGA CCC ... 3' 3' lle Phe Leu 5' C YONGACUGACUGA U UG C 3' 11 & 12 unwichtig 3 Arg Codesonne zur Übersetzung von mRNA-Tripletts in Aminosäuren Exon 11 C A GABUAR Ser A Exon 12 G C U Gin Tyr G His U ASUGA C A G C A G U Stopp Stopp Cys Pro Stopp Trp Leu Exon 12 3' Material 4: Auswirkungen der Punktmutation im Lamin-Gen Die Progerie verursachende Punktmutation liegt in Triplett 608 des Lamin-Gens. In der folgenden Abbildung ist zu sehen, dass eine neue Spleißstelle entstanden ist. gesunder Mensch DNA mRNA Inplett 400 Exon 11 Exon 11 Zellkern Protein Lamin-A Exon 12 Exon 12 Bereich, der durch das Spleißen herausgeschnitten wird Durch Punktmutation entstandene neue Spleißstelle im Lamin-Gen Lamin-C Lamin-A Progerin Lamin-C Exon 11 Einfluss von Progerin auf die Struktur der Kernmembran 505 Material 5: Veränderungen an der Kernmembran durch Progerin Lamin A wird vorwiegend in Zellen der Haut, der Knochen und der Gefäßwände exprimiert. Es bildet zusammen mit dem ebenfalls gebildeten Lamin C nach der Aufnahme in den Zellkern an der Innenseite der Kernmembran polymerisierte Fadenstrukturen, die dafür sorgen, dass der Zellkern seine Form bewahrt. Cytoplasma Progerie-Patient näitte Exon 11 Exon 12 Protein Progerin Exon 12 Cytoplasma -innere Kernmembran Aufgabe B- C- D- E Bio Klausur Diese dann mit 1: Bei der abgebildeten phase der Protein basynthese Translation gezeigt. wird die Bei der zuerst Translation fügen sich Untereinheiten dil des Ribosoms +mRyg einem funktions- fånigem Ribosom zusammen, was Sich dann an die mRNA an- Ribosom ist ein Enzymkomplex und somit nur in lagert. Das 3' → 5' Richtung An der drei Som, die Bindungsstellen mit dem Anfangs-, Mittel- und Abgangsstelle. Im Cytoplasma werden ERNA · Molekule Aminosäure beladen. Ribasom ebeladene tRNA Nr. 2 mRNA entladene tRNA Aminosäure kette ✓ an der ablesbar. Das Ribosom wild nicht MRNA binden sich bilden sich dann abgeleren Ribo- Anticodons der MRNA. Wenn mit einer verbinden sich Anfangsstelle das 12.01.21 der ROA -^- Es ist doch Schon ander mRuA Ribosom dann auf der MBIVA ein Stück weiterrückt gelange das MRIVA, wo die die Enzymen Aminosäure- wird! Die nun dann an -2- Anticodon an Aminosaure mit Hilfe von vorhergehende an die kette angebunden entladene ERNA die Abgangsstelle mRNA entladene ERNA der plasma ist, wird einer nimmt ES gelangt und abgestoßen. wieder Sie SO Translation teil. Aminosäure beladen und wieder schnell an der kommt 20m Translation, wenn (derm BWA Stopp- codon erreicht, da es das Stopp-codon ERIVA gibt. Beim Translation Lost * bildet wird van Sobald die im Cyto wieder mit Abbruch das Ribosom das aus Ribosom Die entstandene Aminosäurekette Nach Beendigung der ist das Protein in عله für passende keine Abbruch der Lost sich der und der komplex MRNA. * das Protein. Translation seiner Primar- Struktur nach Vorgaben nach Vorgaben der DNA entstanden. ✓ Bei der aus der erstellt. Außerdem bei Dieser Vorgang kommt nur Eukaryoten vor und muss Ge- schehen, da die durch die pră-MRIVA nur RNA- Prozessierung zur mRNA reift. Die RNA- Prozessierung besteht aus •Spleißen ± 5' kappe und 3' Schwanz. ganzer Satz t Die introns, also MRNA Abschnitte, die keine genetische information RNA- Prozessierung wird pra-mRNA die MRNA enthalten werden transkribiert, nehmen aber nicht an dir Translation verzögert sie den Abbaute Vorgang der RNA-Drozessieruly) zwischen Transkription und Transe lation statt. Querst wird am pra-mRNA eine teil, somit findet der Das Teile abgewandelten Nucleotiden gesetzt", die die RNA Abbau Schutzt. An das wird عله S' Ende der Kappe aus gehängt, der aus bestent ✓ auf- иск ает ein Poly - A-Schwanz ain- vielen Adeninen 3 Ende Erst Spleißen ungen Splicing Schneidet unwichtige dans Kappe (Schwam pra-mRNA, also die Introns, welche aus Luclectiden be- * der mRNA. was genau? -3- - نا- stenen aus der pră-mRNA unol fügt die Exons, also die Abschnitte die genetische informationen enthalten wieder zusammen. So entstent die MRNA, die nur aus Exons stent. be- Das Lamin-Gen cocliert für zwei Proteine Lamin A und lamin C. и Aus der prä-mRNA für das Cam A- Protein wird das stein wird das Excn 10b neben den introns es aus der MRINA für die Bildung Lamin-A - Proteins nicht wichtig geschnitten, da des ist. V Bei der pra - MRIVA des lamin-C- Proteins werden neben den introns поси Excn 11 und EXON 12 das das herausgeschnitten, da dife nicht wichtig sind und keine weiterer Einflüsse auf die Bildung des lamin- C- Proteins haben. ✓ (3) Lamin-Gen MRNA mutiertes (amin Gen mRNA CAG GUC val CAG GUC val GTG CAC HIS GTG CAC His GGC GGA CCC Das ist der (tode Strang CCG CCU GGG f Pro Pro Gly (0) Folgefehler GGT GGA CCA CCU Pro Pro CCC GGG f Gly (V) Folgefehler f C Bei dem lamin - Gen, welches mutiest ist handelt es sich um eine Slille Mutation, welche eine Punkt- mutation ist und auf die ist und keine Auswirkungen Aminosäure sequenz hat. Außerdem handelt es sich um eine Selection f das heißt, eine Base ist Vertauscht. Z Was ist denn ausgetauscht. Genauer beschreiben Mutation Wissenschaftler sind vorerst nicht davon ausgegangen, dass diese für die Drogerie (nicht) verantwortlich ist, da die Stille Mutation, um um die es sich handelt, keine Auswirkungen auf die Aminosauresequenz haben hat die gleichen und somit trotzdem Aminosäuren codiert werden. bzw. das glache Prokin entsteht Bezugus Phänotyp. ero -5-