Biologie /

Gentechnik

Gentechnik

 Maekül
ал 3. Сабот
EhHQ
Gruppe
VP:
interferrent Troose stopp
30,51 42
Klausur no 2
NP: 42
UN: 13
+ Bitte beachten + Bitte beachten + Bitte

Gentechnik

L

Livia Schneider

41 Followers

Teilen

Speichern

109

 

12

Klausur

Biologie Gentechnik Klausur 12.1 Crispr-Cas; DNA-Sequenzierung; Gentherapie; Genom-editing

Nichts passendes dabei? Erkunde andere Fachbereiche.

Maekül ал 3. Сабот EhHQ Gruppe VP: interferrent Troose stopp 30,51 42 Klausur no 2 NP: 42 UN: 13 + Bitte beachten + Bitte beachten + Bitte beachten + ✓ zwischen den geschriebenen Zeilen eine Zeile frei lassen ✓ Zeichnungen / Graphiken sauber und mit Bleistift & Lineal ✓auf Fachvokabular, Rechtschreibung, Zeichensetzung achten ✓ Seiten nummerieren ✓einen Korrekturrrand lassen fehlt VIEL ERFOLG! OH Gruppe Aufgabe 1-CRISPR - Cas Muskeldystrophien sind ein Gruppe von Erkrankungen, die zu Lähmungen und Muskelabbau führen. Im Kindesalter am häufigsten ist die Duchenne-Muskeldystrophie (DMD), die bereits im jungen Erwachsenenalter durch Lähmung und Abbau der Herz- und Atemmuskulatur zum Tode führen kann. Die Ursache für diesen Typ der Muskeldystrophie sind Mutationen innerhalb eines Gens, das für die Bildung des am Museklaufbau beteiligten Proteins Dystrophin codiert und eines der größten Gene beim Menschen ist. Das Gen besteht aus 79 Exons, wobei das Exon 51 häufig von Mutationen heimgesucht. Die Folge: Der Bauplan wird unlesbar, die Produktion des Proteins wird eingestellt. Eine konventionelle Gentherapie kommt nicht in Frage, da das Dystrophin-Gen dafür zu groß ist - kein viraler Vektor kann einen solchen Riesen in das Erbgut transportieren. Bei Hunden, die ebenfalls an DMD erkranken können, wurde das CRISPR-Cas-System als Therapiemethode eingesetzt und geprüft. Blo Im Rahmen der Behandlung wurde ein vereinfachtes CRISPR-Cas-System eingesetzt: die crRNA so wie die tracrRNA sind zu einer single guide RNA (sgRNA) fusioniert. Diese bilden...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

mit dem jeweiligen Cas-Enzym eine einfach zu handhabende molekulare Schere. Mithilfe der 3'TTTTATCGAGGGTCAGICTGACAATGAGACCACS' Intron t 07.12.2020 Exon 51 Abb. 1 Basensequenz des Exons 51 des Dystophin-Gens, der Pfeil zeigt eine Stelle des Doppelstrangbruches druch das passende CRISPR-Cas- System an Basensequenzanalyse wird die Basenfolge aufgeklärt, sodass der in der sgRNA vorkommende Spacer passgenau im Labor hergestellt werden kann. a. Erkläre auf welcher molekularen Grundlage die DNA-Sequenzierung beruht. b. Erstelle ein Flussdiagramm, das die einzelnen Arbeitsschritte der Methode wiedergibt. C. Fertige eine detaillierte und beschriftete Skizze ganze Seite!) vom Ergebnis der Sequenzierung von Exon 51 an. d. Ermittle die Basensequenz, die der künstlich hergestellte Spacer aufweisen muss, um eine zielgenaue Erkennung des Exons 51 zu ermöglichen. das e. Beschreibe die Vorgehensweise zur Behandlung der Erkrankung durch das CRISPR-Cas-System. Fasse die in Abb. 2 (Vgl. Beamer) dargestellten Versuchsergebnisse zusammen. g. Der Doppelstrangbruch führt dazu, dass die zelleigenen Reparaturmechanismen das Gen ohne Exon 51 wieder zusammensetzen. interpretie белдере Ergebnis der Behan chordlung 4/4VP 12/12VP /1VP /10VP 4/4VP 1,5/3VP Abb. 2 Querschnitt durch die Zwerchfellmuskulatur eines gesunden Beagles (links), eines an MDM leidenden Tieres (Mitte) und eines erkrankten Tiers 6 Wochen nach Genom-Editierung: Dystrophin ist mit grünfluoreszierendem Farbstoff angefärbt UNIVERSITY OF TEXAS SOUTHWESTERN MEDICAL CENTER Aufgabe 2 - Erkläre den Unterschied zwischen einem gentechnisch veränderten Organismus und einem Genom-editierten Organismus. Aufgabe 3-Gentherapie Bactenum carrying plasmirl with clored normal Conetically disabled human ADA gene T cells with disabled ADA gene isolated from SCID patient resrovirus Clones ADA gene is incorporated into virus Retrovirus infects T cells. transfers ADA gene to cells (Klug & Cummings 1997) Cenetically altered cells are reimplanted, produce ADA Cells are grown in culture to ensure ADA gene is active Die Abbildung links stellt die dir bereits bekannte somatische Gentherapie dar. Neben der somatischen Gentherapie gibt es auch die sogenannte Keimbahntherapie. Hierbei handelt es sich um eine Form der Gentherapie, bei der Gene mit Methoden der Gentechnologie in befruchtete Eizellen eingeschleust werden, um mutierte Gene, die z. B. für ein funktionsloses Protein codieren, zu ersetzen, oder mutierte Gene, die für ein verändertes Protein codieren, welches für eine Krankheit verantwortlich ist, zu inaktivieren. Anders als die somatische Gentherapie ist die Keimbahntherapie in Deutschland verboten. Formuliere je ein Argument, dass die Legalität der somatische Gentherapie einerseits bzw. das Verbot der Keimbahntherapie andererseits in Deutschland stützt. Fantastisch......! Ein rechteckiges Ei! Wie geht das denn? Ziemlich trivial..........die genetische Information muss in den Blocksatz! 3/3VP stabi /2VP Milise Bio KA Nr. 2 Alla f 07.12.2020 trasaran a) Bei der DNA - Sequenzierung kommt es zu einem го Abbruch der Transkription durch künstlich veränderte Nukleotice, auch Didesoxy genannt. -Nucleotide Ihnen fehlt am 3. C- Nťom die zweite OH Gruppe, Weshalb die DNA- Polymerase kein weiteres Nuklectic anhängen kann. Es kommt.com Abbruch → → b) DNA - Sequenz Denaturgring Hybridi-yering mit radioaktiv markierten Primerne Probe in 4 Reagenzgläser gegeben - Minzufügen von Desoxy-Nucleotiden und je einer Sorte von Eunstlich veränderten Didesoxy-Nudestiden (dat, das...) Synthese des DNA- 4 Einzeldrangs e zufälliges anbauen росушенавіта • stößt sie auf ein von Desoxy oder Orkesong - wwclectd DNA -Polymerase Polymensination Diksoxy baut komplementären Strang → stößt dünstlich verändertes Nodeotid Sloppy sie do es entstehen underschiedlich lange ZIDNA -Doppelstrange auftrenner and analysieren durch helelektrophorese. c) RÜCKSEITE Dentonierung вассатсаат стая сахтаабассас A G G GT саа тсла асть ттаст стайта Hybrid isieung { бабайт с автстават кGOесос кта Anlagering radioation markietter primer künstich verandae / Nucleotide ст Bentstehende DNA-Fragmente б D ddinum о W 1 - стасса стоссайт са W CICCCAGTCAGA 12 CICC CAGTCA GACISI TA то стсссас темиастапасте 25 го 16 dax о 8 46 d Д 4 CTCCCAGT Така теслательст стс ссастсадастат 17 CICCCAGICAGACTATT стосса го стасскатсаса стапастетасльтсасастапасте стас 22 CTOCCAGT CAGACTATIACT CTCCCAGTCAGACTATTACT CT CTCC CAG TEAGACT GIECCAG TEAG ACTGTI ACT Ехоо пастстранат спастстайта Gelelektrophorese da G ddt О с dd G Обо ddc стссия стос CTOCCAGTCAGACT CTC CCAGTING CTCCC dd C ка CTCC CAGICACACT & CTCCCAGTC 1 CTCCCAGTCAG C13 ICTCCCAGTCAGNICTGTTAC стессасTCAса статті тста + hergestellte Paate spacer muss die тугунената маса aufweisen 7 (d) Der Constlich Basensequenc Spacer = KNA! 4) Abbiklong Abbildong muskulator eines gesunden Beagels auf der linken Seite. In der Mitte sieht man ein an MOM leidendes Tier und rechts eins an TOTSG 76 2 zeigt den Querschnitt durch die Zwerchfellin- nach einer Genown -Editierung. Außerders in Dystrophin mit grünfluoreszierendem Forbsite orspfackt. Da clar gesunde Tier die richtige Hellig kell arleigt, ſieht Mac, dois bei demus in der Mitte erwas nicht ſtimmer. Das reclite Bilel hingagen zeigd ein identisches Farbaussehen, jedoch eine größere Zellstruktur. Die Helligkeit zeigt die Aktivitär des Proteins Dystrophic. Dat is Bei dem Tier in dem mitte kann der Bauplan ven Dystrophin kaum gelesen werden, weshalb die Krankheit schon fortgeschritten islund das dier fast ganzlich getahmi ist. Bei dem rechtin Tier, welches mit Genom - Editierung Dystophix gebildet. Editierung behandelt wurde, schlagholie thempie U TAC Es wird genug Ou e) Bakterien schützen sich mithilfe ven CRISPR-Cas wor Viren. Das kann auch bei Tieren oder Menschen Tieren oder Menschen eingesetzt die tracerRNA sind 20 minmmt man die? Woher. werden. Die GRNO und einer single guide RNA (sgRNA ) Rusioniert. Mit dem Cas- Protein können sie ле eine molekulare Schere Da mur Top Bitten bilden. Um & passende Spacer for die sgRIOA u haben, wird die Basenfolge mit hitfe der Basenrequenzanalyse herausgefunden. Bakterin das (as I Brotein aufweisen, müssen wir dieses herenfiltern und mithilfe eines Vektors, meist wird ein Plasmid verwender, in unser gemom einschleusen. Dann kann das aus mit koull. hergest. Spacer + traveRiNK со

Biologie /

Gentechnik

L

Livia Schneider  

Follow

41 Followers

 Maekül
ал 3. Сабот
EhHQ
Gruppe
VP:
interferrent Troose stopp
30,51 42
Klausur no 2
NP: 42
UN: 13
+ Bitte beachten + Bitte beachten + Bitte

App öffnen

Biologie Gentechnik Klausur 12.1 Crispr-Cas; DNA-Sequenzierung; Gentherapie; Genom-editing

Ähnliche Knows

S

1

Prokaryotische Abwehrreaktion

Know Prokaryotische Abwehrreaktion thumbnail

22

 

11/12/13

H

CRISPR/Cas9, Gentechnik, Genetik

Know CRISPR/Cas9, Gentechnik, Genetik thumbnail

158

 

12

user profile picture

CRISPR-Cas

Know CRISPR-Cas thumbnail

106

 

11/12/13

A

Angewandte

Know Angewandte  thumbnail

4

 

11/12/13

Maekül ал 3. Сабот EhHQ Gruppe VP: interferrent Troose stopp 30,51 42 Klausur no 2 NP: 42 UN: 13 + Bitte beachten + Bitte beachten + Bitte beachten + ✓ zwischen den geschriebenen Zeilen eine Zeile frei lassen ✓ Zeichnungen / Graphiken sauber und mit Bleistift & Lineal ✓auf Fachvokabular, Rechtschreibung, Zeichensetzung achten ✓ Seiten nummerieren ✓einen Korrekturrrand lassen fehlt VIEL ERFOLG! OH Gruppe Aufgabe 1-CRISPR - Cas Muskeldystrophien sind ein Gruppe von Erkrankungen, die zu Lähmungen und Muskelabbau führen. Im Kindesalter am häufigsten ist die Duchenne-Muskeldystrophie (DMD), die bereits im jungen Erwachsenenalter durch Lähmung und Abbau der Herz- und Atemmuskulatur zum Tode führen kann. Die Ursache für diesen Typ der Muskeldystrophie sind Mutationen innerhalb eines Gens, das für die Bildung des am Museklaufbau beteiligten Proteins Dystrophin codiert und eines der größten Gene beim Menschen ist. Das Gen besteht aus 79 Exons, wobei das Exon 51 häufig von Mutationen heimgesucht. Die Folge: Der Bauplan wird unlesbar, die Produktion des Proteins wird eingestellt. Eine konventionelle Gentherapie kommt nicht in Frage, da das Dystrophin-Gen dafür zu groß ist - kein viraler Vektor kann einen solchen Riesen in das Erbgut transportieren. Bei Hunden, die ebenfalls an DMD erkranken können, wurde das CRISPR-Cas-System als Therapiemethode eingesetzt und geprüft. Blo Im Rahmen der Behandlung wurde ein vereinfachtes CRISPR-Cas-System eingesetzt: die crRNA so wie die tracrRNA sind zu einer single guide RNA (sgRNA) fusioniert. Diese bilden...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich einfach.

App öffnen

Alternativer Bildtext:

mit dem jeweiligen Cas-Enzym eine einfach zu handhabende molekulare Schere. Mithilfe der 3'TTTTATCGAGGGTCAGICTGACAATGAGACCACS' Intron t 07.12.2020 Exon 51 Abb. 1 Basensequenz des Exons 51 des Dystophin-Gens, der Pfeil zeigt eine Stelle des Doppelstrangbruches druch das passende CRISPR-Cas- System an Basensequenzanalyse wird die Basenfolge aufgeklärt, sodass der in der sgRNA vorkommende Spacer passgenau im Labor hergestellt werden kann. a. Erkläre auf welcher molekularen Grundlage die DNA-Sequenzierung beruht. b. Erstelle ein Flussdiagramm, das die einzelnen Arbeitsschritte der Methode wiedergibt. C. Fertige eine detaillierte und beschriftete Skizze ganze Seite!) vom Ergebnis der Sequenzierung von Exon 51 an. d. Ermittle die Basensequenz, die der künstlich hergestellte Spacer aufweisen muss, um eine zielgenaue Erkennung des Exons 51 zu ermöglichen. das e. Beschreibe die Vorgehensweise zur Behandlung der Erkrankung durch das CRISPR-Cas-System. Fasse die in Abb. 2 (Vgl. Beamer) dargestellten Versuchsergebnisse zusammen. g. Der Doppelstrangbruch führt dazu, dass die zelleigenen Reparaturmechanismen das Gen ohne Exon 51 wieder zusammensetzen. interpretie белдере Ergebnis der Behan chordlung 4/4VP 12/12VP /1VP /10VP 4/4VP 1,5/3VP Abb. 2 Querschnitt durch die Zwerchfellmuskulatur eines gesunden Beagles (links), eines an MDM leidenden Tieres (Mitte) und eines erkrankten Tiers 6 Wochen nach Genom-Editierung: Dystrophin ist mit grünfluoreszierendem Farbstoff angefärbt UNIVERSITY OF TEXAS SOUTHWESTERN MEDICAL CENTER Aufgabe 2 - Erkläre den Unterschied zwischen einem gentechnisch veränderten Organismus und einem Genom-editierten Organismus. Aufgabe 3-Gentherapie Bactenum carrying plasmirl with clored normal Conetically disabled human ADA gene T cells with disabled ADA gene isolated from SCID patient resrovirus Clones ADA gene is incorporated into virus Retrovirus infects T cells. transfers ADA gene to cells (Klug & Cummings 1997) Cenetically altered cells are reimplanted, produce ADA Cells are grown in culture to ensure ADA gene is active Die Abbildung links stellt die dir bereits bekannte somatische Gentherapie dar. Neben der somatischen Gentherapie gibt es auch die sogenannte Keimbahntherapie. Hierbei handelt es sich um eine Form der Gentherapie, bei der Gene mit Methoden der Gentechnologie in befruchtete Eizellen eingeschleust werden, um mutierte Gene, die z. B. für ein funktionsloses Protein codieren, zu ersetzen, oder mutierte Gene, die für ein verändertes Protein codieren, welches für eine Krankheit verantwortlich ist, zu inaktivieren. Anders als die somatische Gentherapie ist die Keimbahntherapie in Deutschland verboten. Formuliere je ein Argument, dass die Legalität der somatische Gentherapie einerseits bzw. das Verbot der Keimbahntherapie andererseits in Deutschland stützt. Fantastisch......! Ein rechteckiges Ei! Wie geht das denn? Ziemlich trivial..........die genetische Information muss in den Blocksatz! 3/3VP stabi /2VP Milise Bio KA Nr. 2 Alla f 07.12.2020 trasaran a) Bei der DNA - Sequenzierung kommt es zu einem го Abbruch der Transkription durch künstlich veränderte Nukleotice, auch Didesoxy genannt. -Nucleotide Ihnen fehlt am 3. C- Nťom die zweite OH Gruppe, Weshalb die DNA- Polymerase kein weiteres Nuklectic anhängen kann. Es kommt.com Abbruch → → b) DNA - Sequenz Denaturgring Hybridi-yering mit radioaktiv markierten Primerne Probe in 4 Reagenzgläser gegeben - Minzufügen von Desoxy-Nucleotiden und je einer Sorte von Eunstlich veränderten Didesoxy-Nudestiden (dat, das...) Synthese des DNA- 4 Einzeldrangs e zufälliges anbauen росушенавіта • stößt sie auf ein von Desoxy oder Orkesong - wwclectd DNA -Polymerase Polymensination Diksoxy baut komplementären Strang → stößt dünstlich verändertes Nodeotid Sloppy sie do es entstehen underschiedlich lange ZIDNA -Doppelstrange auftrenner and analysieren durch helelektrophorese. c) RÜCKSEITE Dentonierung вассатсаат стая сахтаабассас A G G GT саа тсла асть ттаст стайта Hybrid isieung { бабайт с автстават кGOесос кта Anlagering radioation markietter primer künstich verandae / Nucleotide ст Bentstehende DNA-Fragmente б D ddinum о W 1 - стасса стоссайт са W CICCCAGTCAGA 12 CICC CAGTCA GACISI TA то стсссас темиастапасте 25 го 16 dax о 8 46 d Д 4 CTCCCAGT Така теслательст стс ссастсадастат 17 CICCCAGICAGACTATT стосса го стасскатсаса стапастетасльтсасастапасте стас 22 CTOCCAGT CAGACTATIACT CTCCCAGTCAGACTATTACT CT CTCC CAG TEAGACT GIECCAG TEAG ACTGTI ACT Ехоо пастстранат спастстайта Gelelektrophorese da G ddt О с dd G Обо ddc стссия стос CTOCCAGTCAGACT CTC CCAGTING CTCCC dd C ка CTCC CAGICACACT & CTCCCAGTC 1 CTCCCAGTCAG C13 ICTCCCAGTCAGNICTGTTAC стессасTCAса статті тста + hergestellte Paate spacer muss die тугунената маса aufweisen 7 (d) Der Constlich Basensequenc Spacer = KNA! 4) Abbiklong Abbildong muskulator eines gesunden Beagels auf der linken Seite. In der Mitte sieht man ein an MOM leidendes Tier und rechts eins an TOTSG 76 2 zeigt den Querschnitt durch die Zwerchfellin- nach einer Genown -Editierung. Außerders in Dystrophin mit grünfluoreszierendem Forbsite orspfackt. Da clar gesunde Tier die richtige Hellig kell arleigt, ſieht Mac, dois bei demus in der Mitte erwas nicht ſtimmer. Das reclite Bilel hingagen zeigd ein identisches Farbaussehen, jedoch eine größere Zellstruktur. Die Helligkeit zeigt die Aktivitär des Proteins Dystrophic. Dat is Bei dem Tier in dem mitte kann der Bauplan ven Dystrophin kaum gelesen werden, weshalb die Krankheit schon fortgeschritten islund das dier fast ganzlich getahmi ist. Bei dem rechtin Tier, welches mit Genom - Editierung Dystophix gebildet. Editierung behandelt wurde, schlagholie thempie U TAC Es wird genug Ou e) Bakterien schützen sich mithilfe ven CRISPR-Cas wor Viren. Das kann auch bei Tieren oder Menschen Tieren oder Menschen eingesetzt die tracerRNA sind 20 minmmt man die? Woher. werden. Die GRNO und einer single guide RNA (sgRNA ) Rusioniert. Mit dem Cas- Protein können sie ле eine molekulare Schere Da mur Top Bitten bilden. Um & passende Spacer for die sgRIOA u haben, wird die Basenfolge mit hitfe der Basenrequenzanalyse herausgefunden. Bakterin das (as I Brotein aufweisen, müssen wir dieses herenfiltern und mithilfe eines Vektors, meist wird ein Plasmid verwender, in unser gemom einschleusen. Dann kann das aus mit koull. hergest. Spacer + traveRiNK со