Biologie /

Lösungen + Erklärungen vom AB „Arbeitsblatt: Nucleotidsäuren, DNA Aufbau

Lösungen + Erklärungen vom AB „Arbeitsblatt: Nucleotidsäuren, DNA Aufbau

user profile picture

Olivia

37 Followers
 

Biologie

 

11/10

Übung

Lösungen + Erklärungen vom AB „Arbeitsblatt: Nucleotidsäuren, DNA Aufbau

 Biologie LK Q1
Nucleinsäuren: DNA (Wiederholung)
Aufgaben:
Genetik
Einzelarbeit:
1. Lies den Text auf den Seiten 66 und 67 im Biosphäreband

Kommentare (1)

Teilen

Speichern

4

Hier ist das Lösungsblatt zu den Know „Arbeitsblatt: Nucleotidsäuren, DNA Aufbau

Nichts passendes dabei? Erkunde andere Fachbereiche.

Biologie LK Q1 Nucleinsäuren: DNA (Wiederholung) Aufgaben: Genetik Einzelarbeit: 1. Lies den Text auf den Seiten 66 und 67 im Biosphäreband und bearbeite die nachfolgenden Aufgaben: S-Ende a) Umkreise in der unteren Schemazeichnung eines DNA-Doppelstrangs ein Nukleotid. Beschreibe den Aufbau eines Nucleotids stichwortartig neben der Schemazeichnung. -Ende 3-Ende 5'-Ende Abbildung 1: Molekularer Aufbau der DNA (vereinfacht) Mensch Grünalge Rickad der DNA Phosphodi esterbindes Tabelle: Experimentelle Befunde an verschiedenen DNAS A T 29,9 20,2 Datum: 29,5 20.2 Am Cs- Atom gebunden Phosphat -Base ATTGTCCGAACTAATCTGATTGCC TAA CAGG CTTGATTAGACT AACGG b) Chargaff berichtet 1950, dass die Basenzusammensetzung artspezifisch ist. Ergänze in der Tabelle die prozentualen Angaben der fehlenden Basen der einzelnen Arten. 100-$3,8 = 40,2 | 20,1 G Ist an das C₁ - A ta (kohlenstoff des Zuckers se benden A/G sind Doppel ring spotheme (Porine-Bayon) C+T Pyridine-Basen Zucker (Desoxyribose) T=Thyrin | G=Guanin A = Adenin C = Cytosin C (0,1 20,1 25,8 10040,4 = 59,6 55,61:2 2. Lies den Text auf den Seiten 68 und 69 im Biosphäreband und bearbeite die nachfolgenden Aufgaben: a) Aus der Chargaff-Regel schlossen WATSON und CRICK, dass die Basensequenz des einen Stranges komplementär zur Basensequenz des anderen Stranges sein muss. Ergänze die komplementäre Sequenz des folgenden DNA-Abschnitts: 25,8 Partnerarbeit: 3. Vergleicht eure Lösung der Aufgaben 1 a, b und 2 a. Wenn ihr nicht sicher seid, liegt für die Aufgaben eine Musterlösung auf dem Pult bereit. 4. Besprecht mündlich den Aufbau und die räumliche Struktur der DNA und legt eine Liste mit allen wichtigen Aspekten/Eigenschaften an, die ihr bisher herausgefunden habt. Klärt möglichst alle übrig gebliebenen Fragen! →Bereitet euch...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

darauf vor, den Aufbau und die räumliche Struktur der DNA (also Aufgabe 4) mithilfe von Abbildung 1 vorzustellen. Tipp: Es ist hilfreich, wenn ihr die DNA mit einer Strickleiter vergleicht. Eine:r von euch könnte sich im Vortrag auf die seitlichen Holme, die andere Person auf die Sprossen beziehen. Aufgabe für Schnelle: Die DNA von Grünalgen und die DNA des Menschen werden in zwei verschiedenen Gefäßen erwärmt. In Abhängigkeit von der Temperatur trennen sich die Einzelstränge der DNA-Moleküle immer mehr voneinander. Die DNA wird geschmolzen. Im Spektralfotometer werden die DNA-Lösungen mit UV- Strahlung von 265 nm untersucht. Freie Basen absorbieren mehr UV-Strahlung als gebundene Basen. Der Befund: Bei ca. 65 °C liegt die UV-Absorption der Grünalgen-DNA niedriger als die der DNA des Menschen. Begründen Sie das Versuchsergebnis. Berücksichtigen Sie dafür auch die Tabelle in Aufgabe 2. 4) STRUKTUR Die DNA ahnelt im Aufbau einer Strickleiter. Die Sprossen entsprechen den Basenpaaren → Die Stricke entsprechen der Desoxybrose und der Phosphorsäure Durch unterschiedliche Basensequenzen entstehen Unterschiede in der DNA Die DNA bildet eine Doppelhelix → Die Halbstrange sind komplementan (siehe Basenpaarung) Desoxybrose Phosphor Ein DNA-Nucleotid setzt sich aus folgenen Bausteinen zusammen: Zucker (Desoxyribose) Phosphat einer der Purinbasen Adenin (A) und Guanin (G) oder einer der Pyrimidinbasen Thymin (T) und Cytosin (C) Die Base ist am C₁-Atom (Kohlenstoffatom 1) des Zuckers gebunden, Phosphat am Cs-Atom.

Biologie /

Lösungen + Erklärungen vom AB „Arbeitsblatt: Nucleotidsäuren, DNA Aufbau

Lösungen + Erklärungen vom AB „Arbeitsblatt: Nucleotidsäuren, DNA Aufbau

user profile picture

Olivia

37 Followers
 

Biologie

 

11/10

Übung

Lösungen + Erklärungen vom AB „Arbeitsblatt: Nucleotidsäuren, DNA Aufbau

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 Biologie LK Q1
Nucleinsäuren: DNA (Wiederholung)
Aufgaben:
Genetik
Einzelarbeit:
1. Lies den Text auf den Seiten 66 und 67 im Biosphäreband

App öffnen

Teilen

Speichern

4

Kommentare (1)

F

Vielen Dank, wirklich hilfreich für mich, da wir gerade genau das Thema in der Schule haben 😁

Hier ist das Lösungsblatt zu den Know „Arbeitsblatt: Nucleotidsäuren, DNA Aufbau

Ähnliche Knows

8

Bio Klausur Q1 LK - 14 Punkte

Know Bio Klausur Q1 LK - 14 Punkte  thumbnail

179

 

11

50

Genetik (Grundlagen, Mitose+Meiose, Proteinbiosynthese, DNA-Replikation, Stammbaumanalyse,…))

Know Genetik   (Grundlagen, Mitose+Meiose, Proteinbiosynthese, DNA-Replikation, Stammbaumanalyse,…))  thumbnail

199

 

12/13

8

Genetik Lernzettel Q1

Know Genetik Lernzettel Q1 thumbnail

87

 

11

2

Struktur/ Aufbau der DNA

Know Struktur/ Aufbau der DNA thumbnail

67

 

11/12/10

Mehr

Biologie LK Q1 Nucleinsäuren: DNA (Wiederholung) Aufgaben: Genetik Einzelarbeit: 1. Lies den Text auf den Seiten 66 und 67 im Biosphäreband und bearbeite die nachfolgenden Aufgaben: S-Ende a) Umkreise in der unteren Schemazeichnung eines DNA-Doppelstrangs ein Nukleotid. Beschreibe den Aufbau eines Nucleotids stichwortartig neben der Schemazeichnung. -Ende 3-Ende 5'-Ende Abbildung 1: Molekularer Aufbau der DNA (vereinfacht) Mensch Grünalge Rickad der DNA Phosphodi esterbindes Tabelle: Experimentelle Befunde an verschiedenen DNAS A T 29,9 20,2 Datum: 29,5 20.2 Am Cs- Atom gebunden Phosphat -Base ATTGTCCGAACTAATCTGATTGCC TAA CAGG CTTGATTAGACT AACGG b) Chargaff berichtet 1950, dass die Basenzusammensetzung artspezifisch ist. Ergänze in der Tabelle die prozentualen Angaben der fehlenden Basen der einzelnen Arten. 100-$3,8 = 40,2 | 20,1 G Ist an das C₁ - A ta (kohlenstoff des Zuckers se benden A/G sind Doppel ring spotheme (Porine-Bayon) C+T Pyridine-Basen Zucker (Desoxyribose) T=Thyrin | G=Guanin A = Adenin C = Cytosin C (0,1 20,1 25,8 10040,4 = 59,6 55,61:2 2. Lies den Text auf den Seiten 68 und 69 im Biosphäreband und bearbeite die nachfolgenden Aufgaben: a) Aus der Chargaff-Regel schlossen WATSON und CRICK, dass die Basensequenz des einen Stranges komplementär zur Basensequenz des anderen Stranges sein muss. Ergänze die komplementäre Sequenz des folgenden DNA-Abschnitts: 25,8 Partnerarbeit: 3. Vergleicht eure Lösung der Aufgaben 1 a, b und 2 a. Wenn ihr nicht sicher seid, liegt für die Aufgaben eine Musterlösung auf dem Pult bereit. 4. Besprecht mündlich den Aufbau und die räumliche Struktur der DNA und legt eine Liste mit allen wichtigen Aspekten/Eigenschaften an, die ihr bisher herausgefunden habt. Klärt möglichst alle übrig gebliebenen Fragen! →Bereitet euch...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen

Alternativer Bildtext:

darauf vor, den Aufbau und die räumliche Struktur der DNA (also Aufgabe 4) mithilfe von Abbildung 1 vorzustellen. Tipp: Es ist hilfreich, wenn ihr die DNA mit einer Strickleiter vergleicht. Eine:r von euch könnte sich im Vortrag auf die seitlichen Holme, die andere Person auf die Sprossen beziehen. Aufgabe für Schnelle: Die DNA von Grünalgen und die DNA des Menschen werden in zwei verschiedenen Gefäßen erwärmt. In Abhängigkeit von der Temperatur trennen sich die Einzelstränge der DNA-Moleküle immer mehr voneinander. Die DNA wird geschmolzen. Im Spektralfotometer werden die DNA-Lösungen mit UV- Strahlung von 265 nm untersucht. Freie Basen absorbieren mehr UV-Strahlung als gebundene Basen. Der Befund: Bei ca. 65 °C liegt die UV-Absorption der Grünalgen-DNA niedriger als die der DNA des Menschen. Begründen Sie das Versuchsergebnis. Berücksichtigen Sie dafür auch die Tabelle in Aufgabe 2. 4) STRUKTUR Die DNA ahnelt im Aufbau einer Strickleiter. Die Sprossen entsprechen den Basenpaaren → Die Stricke entsprechen der Desoxybrose und der Phosphorsäure Durch unterschiedliche Basensequenzen entstehen Unterschiede in der DNA Die DNA bildet eine Doppelhelix → Die Halbstrange sind komplementan (siehe Basenpaarung) Desoxybrose Phosphor Ein DNA-Nucleotid setzt sich aus folgenen Bausteinen zusammen: Zucker (Desoxyribose) Phosphat einer der Purinbasen Adenin (A) und Guanin (G) oder einer der Pyrimidinbasen Thymin (T) und Cytosin (C) Die Base ist am C₁-Atom (Kohlenstoffatom 1) des Zuckers gebunden, Phosphat am Cs-Atom.