Transkription; Prozessierung; Spleißen

L

luisa

16 Followers
 

Biologie

 

11/12/13

Ausarbeitung

Transkription; Prozessierung; Spleißen

 Transkription
-> stellt transportfähige Kopien der DNA im
Zellkern her; doppelsträngige DNA->
einzelsträngige RNA (mRNA/messenger RNA)
-DNA

Kommentare (1)

Teilen

Speichern

14

Abbildung & Beschreibung Transkription; Prozessierung/Reifung der RNA; fehlerhaftes Spleißen bei Eukaryoten; Replikation und Transkription im Vergleich

Nichts passendes dabei? Erkunde andere Fachbereiche.

Transkription -> stellt transportfähige Kopien der DNA im Zellkern her; doppelsträngige DNA-> einzelsträngige RNA (mRNA/messenger RNA) -DNA-Doppelhelix wird entbunden und in zwei Einzelstränge getrennt (Wasserstoffbrücken werden zwischen den Basen gelöst) - komplementären Basen lagern sich nach der Basenpaarungsregel (A-U; G-C) am Matrizenstrang an und werden durch das Enzym RNA-Polymerase zu einem RNA-Einzelstrang (mRNA) verkettet - RNA-Polymerase benötigt Informationen, an welchen der beiden DNA-Einzelstränge sie in welche Richtung transkribieren soll -> Steuerungssequenzen: Promotoren, geben die Startstelle und die Transkriptionsrichtung an -> RNA-Polymerase arbeitet nur von 5' nach 3', weshalb der Einzelstrang abgelesen wird, welcher von 3' nach 5' verläuft (codogener Strang) - Transkription endet, wenn die Polymerase auf den Terminator (bestimmte Basensequenz) am Matrizenstrang stößt -> Enzym löst sich vom codogenen Strang und setzt die mRNA frei DNA Transkription prä-mRNA Splicing, Capping, Tailing mRNA Translation Protein Ort (bei Eukaryoten) Zeitpunkt im Zellzyklus Matrize Exon 1 Exon 1 * verantwortl. Syntheseenzym Arbeitsweise d. Syntheseenzyms Syntheserichtung Länge neu gebildeter Nucleotid- stränge Exon 2 Exon 2 1. Start (Initiation) Promotor- Sequenz Exon 3 Exon 3 (A)n RNA- Polymerase fehlerhaftes Spleißen (nur bei Eukaryoten) - Donor-Spleißstelle: GU - Akzeptor-Spleißstelle: AG (am 3'-Ende des Introns) -> kann zu einer Punkt-Mutation führen 3' 5' ADNA Replikation Zellkern S-Phase Beide DNA-Einzelstränge eines Doppelstranges DNA-Polymerase ஒ′உடட பு mRNA UACUGCCUAGUCGGCGUU fertig transkribierte mRNA -> Gendefekt (kann nur eine Base falsch sein) -> führt zu Krankheiten die über Kurz oder Lang mit dem Tod enden 2. Verlängerung (Elongation) Verknüpfung von DNA-Nucleo- tiden auf Grundlage der DNA-Se- quenz des Matrizenstranges 5' → 3' gesamte DNA codogener Strang ATGACGGATCAGO GCAAGCGGAATTGGCGACATAA UACUGCCUAGUCGGCGUÜ RNA- Polymerase TACTGCCTAGTCGGCGTTCGCC TAACCGCTGTATT 5' AACTCCGATCTATGGCTTGGAAGA 3' 3' TTGAGGCTAGATACCGAACCTTCT 5' TC 3' AACUCCGAUCUAUGGCUUGGAAGA 5' Transkription Zellkern G₁-/G₂-Phase codogener Strang der DNA C F A RNA-Polymerase Verknüpfung von RNA-Nucleotiden auf Grundlage der DNA-Sequenz des Matrizenstranges 5' → 3' Abschrift eines kurzen DNA- Abschnitts T9 freie 3. Ende...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

(Termination) RNA-Nukleotide Prozessierung/ Reifung der RNA - prä-mRNA besteht aus Exons und Introns - Zwischenschritt: es docken ein Poly(A) und eine Kappe an die Enden der RNA an, diese schützen vor dem Abbau durch Enzyme. Die Kappe erleichtert außerdem das Andocken an die Ribosome - fertige mRNA: die Introns (nicht codierten Abschnitte) werden heraus geschnitten und es bleiben nur noch die Exons übrig, welche dann mit der Verbindung des Poly(A)'s und der Kappe als Boten-/messenger-RNA dient. Sie ist außerdem die Vorlage für die Protein-Synthese (sie wandert aus dem Zellkern in das Plasma), des Weiteren bezeichnet man die Exons als codierten Abschnitte, was bedeutet, dass sie die Informationen tragen -> die Kappe wird an das 5'-Ende gesetzt und das Poly(A) Stück an das 3'-Ende -> das rausschneiden der Introns, dass danach nur noch die Exons zusammengefügt werden müssen nennt man auch spleißen -> aus prä-mRNA (unreif) wird die mRNA (gereift) -> DNA -> codogener Strang (DNA) -> mRNA Terminator- Sequenz Y RNA- Lasso Struktur die Introns werden in Form von einem Lasso frei gesetzt 3' 5' Polymerase

Transkription; Prozessierung; Spleißen

L

luisa

16 Followers
 

Biologie

 

11/12/13

Ausarbeitung

Transkription; Prozessierung; Spleißen

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 Transkription
-> stellt transportfähige Kopien der DNA im
Zellkern her; doppelsträngige DNA->
einzelsträngige RNA (mRNA/messenger RNA)
-DNA

App öffnen

Teilen

Speichern

14

Kommentare (1)

Y

Vielen Dank, wirklich hilfreich für mich, da wir gerade genau das Thema in der Schule haben 😁

Abbildung & Beschreibung Transkription; Prozessierung/Reifung der RNA; fehlerhaftes Spleißen bei Eukaryoten; Replikation und Transkription im Vergleich

Ähnliche Knows

Genetik

Know Genetik thumbnail

2763

 

11

8

Genetik Lernzettel Q1

Know Genetik Lernzettel Q1 thumbnail

1085

 

11

1

transkription

Know transkription  thumbnail

1992

 

11

3

Proteinbiosynthese

Know Proteinbiosynthese thumbnail

1342

 

11/12/13

Mehr

Transkription -> stellt transportfähige Kopien der DNA im Zellkern her; doppelsträngige DNA-> einzelsträngige RNA (mRNA/messenger RNA) -DNA-Doppelhelix wird entbunden und in zwei Einzelstränge getrennt (Wasserstoffbrücken werden zwischen den Basen gelöst) - komplementären Basen lagern sich nach der Basenpaarungsregel (A-U; G-C) am Matrizenstrang an und werden durch das Enzym RNA-Polymerase zu einem RNA-Einzelstrang (mRNA) verkettet - RNA-Polymerase benötigt Informationen, an welchen der beiden DNA-Einzelstränge sie in welche Richtung transkribieren soll -> Steuerungssequenzen: Promotoren, geben die Startstelle und die Transkriptionsrichtung an -> RNA-Polymerase arbeitet nur von 5' nach 3', weshalb der Einzelstrang abgelesen wird, welcher von 3' nach 5' verläuft (codogener Strang) - Transkription endet, wenn die Polymerase auf den Terminator (bestimmte Basensequenz) am Matrizenstrang stößt -> Enzym löst sich vom codogenen Strang und setzt die mRNA frei DNA Transkription prä-mRNA Splicing, Capping, Tailing mRNA Translation Protein Ort (bei Eukaryoten) Zeitpunkt im Zellzyklus Matrize Exon 1 Exon 1 * verantwortl. Syntheseenzym Arbeitsweise d. Syntheseenzyms Syntheserichtung Länge neu gebildeter Nucleotid- stränge Exon 2 Exon 2 1. Start (Initiation) Promotor- Sequenz Exon 3 Exon 3 (A)n RNA- Polymerase fehlerhaftes Spleißen (nur bei Eukaryoten) - Donor-Spleißstelle: GU - Akzeptor-Spleißstelle: AG (am 3'-Ende des Introns) -> kann zu einer Punkt-Mutation führen 3' 5' ADNA Replikation Zellkern S-Phase Beide DNA-Einzelstränge eines Doppelstranges DNA-Polymerase ஒ′உடட பு mRNA UACUGCCUAGUCGGCGUU fertig transkribierte mRNA -> Gendefekt (kann nur eine Base falsch sein) -> führt zu Krankheiten die über Kurz oder Lang mit dem Tod enden 2. Verlängerung (Elongation) Verknüpfung von DNA-Nucleo- tiden auf Grundlage der DNA-Se- quenz des Matrizenstranges 5' → 3' gesamte DNA codogener Strang ATGACGGATCAGO GCAAGCGGAATTGGCGACATAA UACUGCCUAGUCGGCGUÜ RNA- Polymerase TACTGCCTAGTCGGCGTTCGCC TAACCGCTGTATT 5' AACTCCGATCTATGGCTTGGAAGA 3' 3' TTGAGGCTAGATACCGAACCTTCT 5' TC 3' AACUCCGAUCUAUGGCUUGGAAGA 5' Transkription Zellkern G₁-/G₂-Phase codogener Strang der DNA C F A RNA-Polymerase Verknüpfung von RNA-Nucleotiden auf Grundlage der DNA-Sequenz des Matrizenstranges 5' → 3' Abschrift eines kurzen DNA- Abschnitts T9 freie 3. Ende...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen

Alternativer Bildtext:

(Termination) RNA-Nukleotide Prozessierung/ Reifung der RNA - prä-mRNA besteht aus Exons und Introns - Zwischenschritt: es docken ein Poly(A) und eine Kappe an die Enden der RNA an, diese schützen vor dem Abbau durch Enzyme. Die Kappe erleichtert außerdem das Andocken an die Ribosome - fertige mRNA: die Introns (nicht codierten Abschnitte) werden heraus geschnitten und es bleiben nur noch die Exons übrig, welche dann mit der Verbindung des Poly(A)'s und der Kappe als Boten-/messenger-RNA dient. Sie ist außerdem die Vorlage für die Protein-Synthese (sie wandert aus dem Zellkern in das Plasma), des Weiteren bezeichnet man die Exons als codierten Abschnitte, was bedeutet, dass sie die Informationen tragen -> die Kappe wird an das 5'-Ende gesetzt und das Poly(A) Stück an das 3'-Ende -> das rausschneiden der Introns, dass danach nur noch die Exons zusammengefügt werden müssen nennt man auch spleißen -> aus prä-mRNA (unreif) wird die mRNA (gereift) -> DNA -> codogener Strang (DNA) -> mRNA Terminator- Sequenz Y RNA- Lasso Struktur die Introns werden in Form von einem Lasso frei gesetzt 3' 5' Polymerase