Biologie /

Der genetische Code

Der genetische Code

 IDER
-Genetische Code
.-In mRNA ist die Strucktur des Polypeptids durch die
Reihenfolge des Aminosäuren, die Aminosäuresequenz,
festgelegt

Der genetische Code

user profile picture

Lea

112 Followers

Teilen

Speichern

153

 

11/12/10

Lernzettel

Die Eigenschaften des genetischen Codes und die Code-Sonne

Nichts passendes dabei? Erkunde andere Fachbereiche.

IDER -Genetische Code .-In mRNA ist die Strucktur des Polypeptids durch die Reihenfolge des Aminosäuren, die Aminosäuresequenz, festgelegt - 3 Basen = 1. Basentriplett / Codon. - 1 Codon codiert 1. Aminosäure ↳es ergeben sich. 4³ = 64. Kombinationsmöglichkeiten - Es gibt 20 Aminosäuren, also werden fast alle Amino- säuren durch mehrere Tripletts.codiert. Die Eigenschaften des genetischen Codes: 1. Er ist ein Triplet+ Code. Es codieren immer 3 Basen. .- ein Codon- eine Aminosäure 2. Er ist universen. Alle Lebewesen nutzen diesen Code. Nur bei wenigen Ausnahmen codieren bestimmte Godes andere Aminosäuren.. 3. Er ist eindeutig. Jedes Codon codiert nur eine. Amino- säure.. Weiteres: -Er wird nur in 5'→ 3' Richtung angegeben - Start codon: AUG → Met → Methionin - Stopp-Codons: UAG, VAA, UGA. Beispiel: 3' Val 3'- TACAAGCAGTTAGTCGTGGAAACACCAAGTTAT -5' 5'- ATGTTCGTCAATCAGCACCTTTGTGGTTCAATA -3' MANA: 5'- AUGUUC GUCAA UCAGCACCUUUGUGG UUCAAUA - 3¹ Met(Start)-Phe-Val-Asn-Gln-His-Leu-Cys - Gly-Ser- lle AS-Seg: M - F - V-N-Q-H-L-C-GS-) Ser 4. Er ist redundant /degeneriert. Fast alle. Aminosäuren werden durch mehrere Tripletts, codiert. 5. Er ist kommafrei. Die Cooons schließen lückenlos aneinander.. 6. Er ist nicht überlappend. Eine Base ist immer nur Bestandteil eines Codons. Ala Lys Asp Asn Glu 2040 2040 2040 Use G A Gly Thr с Start Met 3' Phe •POUGACUGACUGACUGACLO TOC GU lle UCAGUCAGUOTO с GU-T A G S'= Uracil A C U C A Leu UG 3' Ser Arg Gln ১০৫৩১০ Drei-Buchstaben-Code der Aminosäuren: Ala (A) - Alanin Gly (G)- Glycin Arg (R) - Arginin His (H) - Histidin Asp (D)-Asparaginsäure lle (1) -Isoleucin Asn (N)-Asparagin Cys (C) - Cystein Leu (L) - Leucin Lys (K) - Lysin Met (M) - Methionin Phe (F) – Phenylalanin Gln (Q) - Glutamin Glu (E) - Glutaminsäure His Tyr Stopp Stopp Cys Pro Trp Leu Stopp 3' Pro (P) - Prolin Ser (S) -...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

Serin Thr (T)-Threonin Trp (W) - Tryptophan Tyr (Y) - Tyrosin Val (V) - Valin

Biologie /

Der genetische Code

user profile picture

Lea   

Follow

112 Followers

 IDER
-Genetische Code
.-In mRNA ist die Strucktur des Polypeptids durch die
Reihenfolge des Aminosäuren, die Aminosäuresequenz,
festgelegt

App öffnen

Die Eigenschaften des genetischen Codes und die Code-Sonne

Ähnliche Knows

user profile picture

1

Genetischer Code; DNA in mRNA übersetzen

Know Genetischer Code; DNA in mRNA übersetzen thumbnail

15

 

11/12/13

F

3

Aufbau der DNA und der genetische Code

Know Aufbau der DNA und der genetische Code thumbnail

2

 

11/12

user profile picture

1

Der genetische Code

Know Der genetische Code thumbnail

0

 

11/12/13

user profile picture

Proteinbiosynthese, Transkription, Translation & mehr

Know Proteinbiosynthese, Transkription, Translation & mehr  thumbnail

11

 

12

IDER -Genetische Code .-In mRNA ist die Strucktur des Polypeptids durch die Reihenfolge des Aminosäuren, die Aminosäuresequenz, festgelegt - 3 Basen = 1. Basentriplett / Codon. - 1 Codon codiert 1. Aminosäure ↳es ergeben sich. 4³ = 64. Kombinationsmöglichkeiten - Es gibt 20 Aminosäuren, also werden fast alle Amino- säuren durch mehrere Tripletts.codiert. Die Eigenschaften des genetischen Codes: 1. Er ist ein Triplet+ Code. Es codieren immer 3 Basen. .- ein Codon- eine Aminosäure 2. Er ist universen. Alle Lebewesen nutzen diesen Code. Nur bei wenigen Ausnahmen codieren bestimmte Godes andere Aminosäuren.. 3. Er ist eindeutig. Jedes Codon codiert nur eine. Amino- säure.. Weiteres: -Er wird nur in 5'→ 3' Richtung angegeben - Start codon: AUG → Met → Methionin - Stopp-Codons: UAG, VAA, UGA. Beispiel: 3' Val 3'- TACAAGCAGTTAGTCGTGGAAACACCAAGTTAT -5' 5'- ATGTTCGTCAATCAGCACCTTTGTGGTTCAATA -3' MANA: 5'- AUGUUC GUCAA UCAGCACCUUUGUGG UUCAAUA - 3¹ Met(Start)-Phe-Val-Asn-Gln-His-Leu-Cys - Gly-Ser- lle AS-Seg: M - F - V-N-Q-H-L-C-GS-) Ser 4. Er ist redundant /degeneriert. Fast alle. Aminosäuren werden durch mehrere Tripletts, codiert. 5. Er ist kommafrei. Die Cooons schließen lückenlos aneinander.. 6. Er ist nicht überlappend. Eine Base ist immer nur Bestandteil eines Codons. Ala Lys Asp Asn Glu 2040 2040 2040 Use G A Gly Thr с Start Met 3' Phe •POUGACUGACUGACUGACLO TOC GU lle UCAGUCAGUOTO с GU-T A G S'= Uracil A C U C A Leu UG 3' Ser Arg Gln ১০৫৩১০ Drei-Buchstaben-Code der Aminosäuren: Ala (A) - Alanin Gly (G)- Glycin Arg (R) - Arginin His (H) - Histidin Asp (D)-Asparaginsäure lle (1) -Isoleucin Asn (N)-Asparagin Cys (C) - Cystein Leu (L) - Leucin Lys (K) - Lysin Met (M) - Methionin Phe (F) – Phenylalanin Gln (Q) - Glutamin Glu (E) - Glutaminsäure His Tyr Stopp Stopp Cys Pro Trp Leu Stopp 3' Pro (P) - Prolin Ser (S) -...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich einfach.

App öffnen

Alternativer Bildtext:

Serin Thr (T)-Threonin Trp (W) - Tryptophan Tyr (Y) - Tyrosin Val (V) - Valin