Biologie /

DNA Aufbau

DNA Aufbau

user profile picture

Lia

243 Followers
 

Biologie

 

11/9/10

Lernzettel

DNA Aufbau

 DESOXYRIBONUKLEINSÄURE
Desoxyribonukleinsäure DNS bzw. auf englisch DNA (deoxyribonucleic acid) ist die Eibsubstanz
eines jeden Lebewesen.

Kommentare (1)

Teilen

Speichern

9

Wie ist die DNA aufgebaut und wie funktioniert sie?

Nichts passendes dabei? Erkunde andere Fachbereiche.

DESOXYRIBONUKLEINSÄURE Desoxyribonukleinsäure DNS bzw. auf englisch DNA (deoxyribonucleic acid) ist die Eibsubstanz eines jeden Lebewesen. In der Regel liegt sie in Form von Chromosomen vor, welche aus Chromatiden bestehen. Dieser wiederum bestehen aus DNA Fäden. Wenn man alle dieser Foiden zusammen tun würde wären sie über 2m lang. Sie sind kompliziert verpackt, aber ihr Hauptbestandteil ist das Protein Histon, welches die DNA Föden wie ein docken- wickler zwei mal umwickelt. Ein DNA Facken besteht aus 2 Strängen, die mit Querver - bindungen verbunden werden und ineinander verdreht sind. Diese Form nennt man Dopperhelik. Wenn man sich dies wie eine Strickleiter vorstellt, besteht die Seile cler deiter aus Zucker (Desoxyribose) und Phosphat. Die beiden Stränge verlaufen antiparallel, wodurch ein 5-Ende und ein 3'- Ende entsteht. Als Sprossen" cler Leiter dienen clie vier Nucleinbasen Adenin, Thymin, Guanin und Cylosin die mit dem Zucker verbunden sind. Zwei Nuclein basen bilden eine Sprasse. Allerdings können sich nur komplementare Basen verbinden, also Adenin mit Thymin und Guanin mit Cytosin.. • "0 Basenpaar Chromosom DNA- •Chromatinfaden Faden A= Adenin C=Cytosin T=Thymin 6=Guamin Heston Nukleosom Zucker - Phosphat - Band ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT Nukleotid Phosphat Desoxyribose HO G с AT A G T C G G T Wasserstoffbrücken Base C с A G OH

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Biologie /

DNA Aufbau

DNA Aufbau

user profile picture

Lia

243 Followers
 

Biologie

 

11/9/10

Lernzettel

DNA Aufbau

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 DESOXYRIBONUKLEINSÄURE
Desoxyribonukleinsäure DNS bzw. auf englisch DNA (deoxyribonucleic acid) ist die Eibsubstanz
eines jeden Lebewesen.

App öffnen

Teilen

Speichern

9

Kommentare (1)

Q

Cool, mit dem Lernzettel konnte ich mich richtig gut auf meine Klassenarbeit vorbereiten. Danke 👍👍

Wie ist die DNA aufgebaut und wie funktioniert sie?

Ähnliche Knows

31

Genetik Bio Abi 2022

Know Genetik Bio Abi 2022  thumbnail

408

 

11/12/13

3

Aufbau der DNA

Know Aufbau der DNA thumbnail

121

 

11/12/13

1

Molekularer Aufbau der DNA Text Zusammenfassung

Know Molekularer Aufbau der DNA Text Zusammenfassung  thumbnail

152

 

11/12/13

2

Struktur/ Aufbau der DNA

Know Struktur/ Aufbau der DNA thumbnail

67

 

11/12/10

Mehr

DESOXYRIBONUKLEINSÄURE Desoxyribonukleinsäure DNS bzw. auf englisch DNA (deoxyribonucleic acid) ist die Eibsubstanz eines jeden Lebewesen. In der Regel liegt sie in Form von Chromosomen vor, welche aus Chromatiden bestehen. Dieser wiederum bestehen aus DNA Fäden. Wenn man alle dieser Foiden zusammen tun würde wären sie über 2m lang. Sie sind kompliziert verpackt, aber ihr Hauptbestandteil ist das Protein Histon, welches die DNA Föden wie ein docken- wickler zwei mal umwickelt. Ein DNA Facken besteht aus 2 Strängen, die mit Querver - bindungen verbunden werden und ineinander verdreht sind. Diese Form nennt man Dopperhelik. Wenn man sich dies wie eine Strickleiter vorstellt, besteht die Seile cler deiter aus Zucker (Desoxyribose) und Phosphat. Die beiden Stränge verlaufen antiparallel, wodurch ein 5-Ende und ein 3'- Ende entsteht. Als Sprossen" cler Leiter dienen clie vier Nucleinbasen Adenin, Thymin, Guanin und Cylosin die mit dem Zucker verbunden sind. Zwei Nuclein basen bilden eine Sprasse. Allerdings können sich nur komplementare Basen verbinden, also Adenin mit Thymin und Guanin mit Cytosin.. • "0 Basenpaar Chromosom DNA- •Chromatinfaden Faden A= Adenin C=Cytosin T=Thymin 6=Guamin Heston Nukleosom Zucker - Phosphat - Band ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT Nukleotid Phosphat Desoxyribose HO G с AT A G T C G G T Wasserstoffbrücken Base C с A G OH

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen