Biologie /

Genetik Bio Abi 2022

Genetik Bio Abi 2022

user profile picture

Hanna H

80 Followers
 

Biologie

 

11/12/13

Lernzettel

Genetik Bio Abi 2022

 Genetik Übersicht
Zytologie
Aufbau DNA
DNA-Replikation
Proteinbiosynthese
Transkription
Translation
Code Sonne
Genregulation
Substrat-Induk

Kommentare (3)

Teilen

Speichern

410

Zusammenfassung Genetik für Gk (NRW)

Nichts passendes dabei? Erkunde andere Fachbereiche.

Genetik Übersicht Zytologie Aufbau DNA DNA-Replikation Proteinbiosynthese Transkription Translation Code Sonne Genregulation Substrat-Induktion Endprodukt-Repression Gentechnik Werkzeuge der Gentechnik Methoden der Gentechnik Bioethik Mutationen Genommutationen Chromosommutationen Genmutationen Meiose Stammbaumanalyse Zytologie Eukaryote Tierzelle Zellmembran- Endoplasmatisches Reticulum (ER) mit Ribosomen Mitochondrien- Lysosomen Pflanzenzelle Cytoplasma Chloroplasten. Zellkern mit Nucleo lus Golgi-Apparat- Vakuole Prokaryote Bakterie Zellmembran Cytoplasma Ribosomen Pili Cytoplasma Zellkem mit Nucleolus Golgi- Apparat Gly koka lix ss Cyto skelett Chromoplast Endoplasmatisches Reticulum (ER) mit Ribosomen Mitochondrien Zellwand Zellwand Nocleoid Plasmid Geißel DNA (DNS) - Desoxyribonukleinsäure DNA = deoxyribonucleic acid (englischer Begriff) DNS = Desoxyribonukleinsäure Was ist die DNA? -> kommt in jeder Zelle des Körpers vor -> Prokaryoten -> schwimmt frei im Cytoplasma -> Die DNA liegt im Zellkern der Eukaryoten, genauer gesagt ist ein Bestandteil der im Zellkern liegenden Chromosomen, die die genetischen Anweisungen gespeichert haben. Nucleotide -> Bausteine der DNA, die zu langen Fäden, der DNA verknüpft werden Bestandteile der Nucleotide: • Desoxyribose (Zucker) CH₂OH 4H H 0 P | NH O OH H • Phosphat O Adenin H O || 0 P 1 OH NH₂ H O™ 0° chemischer Aufbau Uhrzeigersinn nummeriert (wichtig H = Desoxy lohne Sauerstoff deswegen • stickstoffhaltige Base (Adenin (A), Thymin (T), Cytosin (C) und Guanin (G)) ● Im H₂C. O= NH Thymin Chemischer Aufbau Nucleotid: Esterbindung CH₂ 4H NH 13 -> Pyrimidin-Basen - sechseckige Moleküle -> Purin-Basen - OH H3C. NH₂ NH Cytosin H zur nur NH Orientierung! H) NH Guanin fünf- und sechseckiges Gerüst (mit Thymin) NH NH₂ N-glykosidische Bindung Aufbau DNA - zwei antiparallele, umeinander gedrehte Zuckerphosphatbändchen, zwischen denen die Basenpaare strickleiterartig angeordnet sind (5` -> 3' oder 3` -> 5') am 5' Ende befindet sich Phosphat am 3' Ende befindet sich eine OH-Gruppe -> unterschiedliche Enden geben der DNA ihre Orientierung - Struktur einer Doppelhelix - Wasserstoffbrückenbindung zwischen den übereinanderliegenden aromatischen Ringen der Basen (= Stapelkräfte) -> stabilisieren die Raumstruktur -> verknüpfen die Basen (Adenin&Thymin=2, Gunanin&Cytosin=3) - TA-Stapel weniger Stabil (wegen fehlender Aminogruppe bei Thymin) höherer CG-Gehalt = größere Stabilität - die Abfolge der Basen codiert die Erbinformation DNA Verpackung DNA ↓↓ Nucleosomen ↓ Filament ↓ Rosette ↓ Chromatid ↓ Chromosom Rosette Aufgaben der DNA Speicherung der Erbinformationen - Weitergabe der Erbinformationen - Steuerung der Lebensvorgänge - NNN Chromosome Chromatid Filament = Adenin Thymin Cytosin Histones = = Guanin Phosphat- =...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

desoxyribose Strang Eine Gruppe von Proteinen, die wie ,,Lockenwickler" wirken. Dadurch entstehen Nucleosome Nucleosome DNA helix ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT

Biologie /

Genetik Bio Abi 2022

Genetik Bio Abi 2022

user profile picture

Hanna H

80 Followers
 

Biologie

 

11/12/13

Lernzettel

Genetik Bio Abi 2022

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 Genetik Übersicht
Zytologie
Aufbau DNA
DNA-Replikation
Proteinbiosynthese
Transkription
Translation
Code Sonne
Genregulation
Substrat-Induk

App öffnen

Teilen

Speichern

410

Kommentare (3)

Q

So ein schöner Lernzettel 😍😍 super nützlich und hilfreich!

Zusammenfassung Genetik für Gk (NRW)

Ähnliche Knows

3

Aufbau DNA

Know Aufbau DNA  thumbnail

170

 

10

3

Aufbau der DNA

Know Aufbau der DNA thumbnail

122

 

11/12/13

DNA

Know DNA thumbnail

431

 

11/12/13

1

Raumstruktur der DNA

Know Raumstruktur der DNA thumbnail

72

 

11/12

Mehr

Genetik Übersicht Zytologie Aufbau DNA DNA-Replikation Proteinbiosynthese Transkription Translation Code Sonne Genregulation Substrat-Induktion Endprodukt-Repression Gentechnik Werkzeuge der Gentechnik Methoden der Gentechnik Bioethik Mutationen Genommutationen Chromosommutationen Genmutationen Meiose Stammbaumanalyse Zytologie Eukaryote Tierzelle Zellmembran- Endoplasmatisches Reticulum (ER) mit Ribosomen Mitochondrien- Lysosomen Pflanzenzelle Cytoplasma Chloroplasten. Zellkern mit Nucleo lus Golgi-Apparat- Vakuole Prokaryote Bakterie Zellmembran Cytoplasma Ribosomen Pili Cytoplasma Zellkem mit Nucleolus Golgi- Apparat Gly koka lix ss Cyto skelett Chromoplast Endoplasmatisches Reticulum (ER) mit Ribosomen Mitochondrien Zellwand Zellwand Nocleoid Plasmid Geißel DNA (DNS) - Desoxyribonukleinsäure DNA = deoxyribonucleic acid (englischer Begriff) DNS = Desoxyribonukleinsäure Was ist die DNA? -> kommt in jeder Zelle des Körpers vor -> Prokaryoten -> schwimmt frei im Cytoplasma -> Die DNA liegt im Zellkern der Eukaryoten, genauer gesagt ist ein Bestandteil der im Zellkern liegenden Chromosomen, die die genetischen Anweisungen gespeichert haben. Nucleotide -> Bausteine der DNA, die zu langen Fäden, der DNA verknüpft werden Bestandteile der Nucleotide: • Desoxyribose (Zucker) CH₂OH 4H H 0 P | NH O OH H • Phosphat O Adenin H O || 0 P 1 OH NH₂ H O™ 0° chemischer Aufbau Uhrzeigersinn nummeriert (wichtig H = Desoxy lohne Sauerstoff deswegen • stickstoffhaltige Base (Adenin (A), Thymin (T), Cytosin (C) und Guanin (G)) ● Im H₂C. O= NH Thymin Chemischer Aufbau Nucleotid: Esterbindung CH₂ 4H NH 13 -> Pyrimidin-Basen - sechseckige Moleküle -> Purin-Basen - OH H3C. NH₂ NH Cytosin H zur nur NH Orientierung! H) NH Guanin fünf- und sechseckiges Gerüst (mit Thymin) NH NH₂ N-glykosidische Bindung Aufbau DNA - zwei antiparallele, umeinander gedrehte Zuckerphosphatbändchen, zwischen denen die Basenpaare strickleiterartig angeordnet sind (5` -> 3' oder 3` -> 5') am 5' Ende befindet sich Phosphat am 3' Ende befindet sich eine OH-Gruppe -> unterschiedliche Enden geben der DNA ihre Orientierung - Struktur einer Doppelhelix - Wasserstoffbrückenbindung zwischen den übereinanderliegenden aromatischen Ringen der Basen (= Stapelkräfte) -> stabilisieren die Raumstruktur -> verknüpfen die Basen (Adenin&Thymin=2, Gunanin&Cytosin=3) - TA-Stapel weniger Stabil (wegen fehlender Aminogruppe bei Thymin) höherer CG-Gehalt = größere Stabilität - die Abfolge der Basen codiert die Erbinformation DNA Verpackung DNA ↓↓ Nucleosomen ↓ Filament ↓ Rosette ↓ Chromatid ↓ Chromosom Rosette Aufgaben der DNA Speicherung der Erbinformationen - Weitergabe der Erbinformationen - Steuerung der Lebensvorgänge - NNN Chromosome Chromatid Filament = Adenin Thymin Cytosin Histones = = Guanin Phosphat- =...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen

Alternativer Bildtext:

desoxyribose Strang Eine Gruppe von Proteinen, die wie ,,Lockenwickler" wirken. Dadurch entstehen Nucleosome Nucleosome DNA helix ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT