Genetischer Fingerabdruck (STR)

L

Lana

16 Followers
 

Biologie

 

11

Lernzettel

Genetischer Fingerabdruck (STR)

 Grundsätzliche Infos:
Für dieses Prinzip wird mit der PCR ein spezieller DNA-Abschnitt vervielfältigt (es muss ein nicht-codierender
sein).

Kommentare (1)

Teilen

Speichern

10

STR-Analyse

Nichts passendes dabei? Erkunde andere Fachbereiche.

Grundsätzliche Infos: Für dieses Prinzip wird mit der PCR ein spezieller DNA-Abschnitt vervielfältigt (es muss ein nicht-codierender sein). Diese Abschnitte setzen sich aus kurzen gleicharligen Sequenzen zusammen. Eine Sequenz bzw. ein repeat besteht aus 2-10 Basenpaaren. Die repeats werden tandemartig 3-40 Mal wiederholt & deswegel als small tandem repeats (STR) bezeichnet. Die Abfolge der Basen der STRs ist bei jedem Menschen gleich, jedoch wie viele wiederholungen es gibt variiert von Mensch zu Mensch. Somit ist die länge der DNA-Abschnitte ein charakteristisches Merkmal. Auswertung der STRs: 1. zählen wie viele STRs vorhanden sind 2. Mit dem Ergebniss der Gelelektrophorese vergleichen & ggf. einzeichnen 3. Täter identifizieren (Beispiel) M1 Ausgewählte DNA-Fragmente von drei Tatverdächtigen Beispiel Spur 1 2 3 Tatverdächtiger 1 1 2 3 2 3 4 DNA-Basensequenz 5 Genetischer Fingerabdruck (STR Analyse) 5 5'TAACGGAACTGATAGATAGATAGATAGATAGATAGATAAGCTGATTGC³ 28 TAACGGAACTGATAGATAGATAGATAGATAGATAGATAGATAAGCTGATTGC³ 32 TAACGGAACTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAGCTGATTGC³' 40 5 S'TAACGGAACTGATAGATAGATAGATAGATAAGCTGATTGC 20 M2 Vergleich der Spuren mithilfe des genetischen Fingerabdrucks Spur Spur 1: TAACGGAACTGATAGATAGATAGATAGATAGATAGATAGATAGATAAGCTGATTGC³ 36 5'TAACGGAACTGATAGATAGATAAGCTGATTGC³ 12 40 bp 35 bp 30 bp 25 bp 20 bp 15 bp Spur 2: Spur 3: Spur 4: Haarprobe des Tatverdächtigen 1 (Martin V.) Täter Haarprobe des Tatverdächtigen 2 keine Übereinstimmung Haarprobe des Tatverdächtigen 3 Bandenmuster der DNA aus den am Tatort gefundenen Haaren Übereinstimmung

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Genetischer Fingerabdruck (STR)

L

Lana

16 Followers
 

Biologie

 

11

Lernzettel

Genetischer Fingerabdruck (STR)

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 Grundsätzliche Infos:
Für dieses Prinzip wird mit der PCR ein spezieller DNA-Abschnitt vervielfältigt (es muss ein nicht-codierender
sein).

App öffnen

Teilen

Speichern

10

Kommentare (1)

T

Cool, mit dem Lernzettel konnte ich mich richtig gut auf meine Klassenarbeit vorbereiten. Danke 👍👍

STR-Analyse

Ähnliche Knows

2

Gelelektrophorese

Know Gelelektrophorese  thumbnail

2816

 

12

Genetischer Fingerabdruck

Know Genetischer Fingerabdruck  thumbnail

1959

 

11/12/10

Gentechnische Werkzeuge & Verfahren | Genetik

Know Gentechnische Werkzeuge & Verfahren | Genetik thumbnail

5033

 

11/12/13

8

Übungsklausur Gentechnik

Know Übungsklausur Gentechnik thumbnail

1126

 

11/12/13

Mehr

Grundsätzliche Infos: Für dieses Prinzip wird mit der PCR ein spezieller DNA-Abschnitt vervielfältigt (es muss ein nicht-codierender sein). Diese Abschnitte setzen sich aus kurzen gleicharligen Sequenzen zusammen. Eine Sequenz bzw. ein repeat besteht aus 2-10 Basenpaaren. Die repeats werden tandemartig 3-40 Mal wiederholt & deswegel als small tandem repeats (STR) bezeichnet. Die Abfolge der Basen der STRs ist bei jedem Menschen gleich, jedoch wie viele wiederholungen es gibt variiert von Mensch zu Mensch. Somit ist die länge der DNA-Abschnitte ein charakteristisches Merkmal. Auswertung der STRs: 1. zählen wie viele STRs vorhanden sind 2. Mit dem Ergebniss der Gelelektrophorese vergleichen & ggf. einzeichnen 3. Täter identifizieren (Beispiel) M1 Ausgewählte DNA-Fragmente von drei Tatverdächtigen Beispiel Spur 1 2 3 Tatverdächtiger 1 1 2 3 2 3 4 DNA-Basensequenz 5 Genetischer Fingerabdruck (STR Analyse) 5 5'TAACGGAACTGATAGATAGATAGATAGATAGATAGATAAGCTGATTGC³ 28 TAACGGAACTGATAGATAGATAGATAGATAGATAGATAGATAAGCTGATTGC³ 32 TAACGGAACTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAGCTGATTGC³' 40 5 S'TAACGGAACTGATAGATAGATAGATAGATAAGCTGATTGC 20 M2 Vergleich der Spuren mithilfe des genetischen Fingerabdrucks Spur Spur 1: TAACGGAACTGATAGATAGATAGATAGATAGATAGATAGATAGATAAGCTGATTGC³ 36 5'TAACGGAACTGATAGATAGATAAGCTGATTGC³ 12 40 bp 35 bp 30 bp 25 bp 20 bp 15 bp Spur 2: Spur 3: Spur 4: Haarprobe des Tatverdächtigen 1 (Martin V.) Täter Haarprobe des Tatverdächtigen 2 keine Übereinstimmung Haarprobe des Tatverdächtigen 3 Bandenmuster der DNA aus den am Tatort gefundenen Haaren Übereinstimmung

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich Einfach.

App öffnen