Biologie /

Gentechnik

Gentechnik

 Biologie Abitur
1. Gentechnik
Gentechnik
Transgene Zellen
Genom
Angewandte Genetik und Reproduktionsbiologie
Verfahren, durch die fremde Ge

Gentechnik

user profile picture

Isabell

147 Followers

Teilen

Speichern

244

 

11/12/13

Lernzettel

Lernzettel für das Biologie Abitur 2021 in Baden-Württemberg über den Themenbereich Gentechnik

Nichts passendes dabei? Erkunde andere Fachbereiche.

Biologie Abitur 1. Gentechnik Gentechnik Transgene Zellen Genom Angewandte Genetik und Reproduktionsbiologie Verfahren, durch die fremde Gene in eine Zelle übertragen werden, plus die Analyse, Veränderung und die Vervielfältigung der DNA oder RNA Zellen, die ein fremdes Gen in ihrem Genom aufgenommen haben Gesamtheit aller Gene Arbeitsschritte um transgene Zellen herzustellen: 1) Gewinnung des Gens: Der betreffende DNA-Abschnitt muss isoliert oder synthetisiert werden 2) Transfer des Gens: Der DNA-Abschnitt muss durch die Zellmembran in die Zelle eingeschleust werden 3) Vervielfältigung der transgenen Zelle: Transgene Zelle mit dem darin enthaltenen Fremdgen muss vermehrt werden 4) Selektion transgener Zellen: Zellen, bei denen der Gentransfer gelungen ist, die also das Fremdgen aufgenommen haben, müssen erkannt und herausgesucht werden 1.1 Gewinnung eines Gens Isolierung eines Gens aus der DNA eines Spenderorganismus: Restriktionsenzyme Enzyme in Bakterien, welche eingedrungene virale-DNA zerschneiden und unschädlich machen Restriktionsenzyme zerlegen DNA-Moleküle wie Scheren in kleine - Restriktionsenzyme haben immer unterschiedliche Erkennungssequenzen und schneiden so, dass ein kurzes Stück Einzelstrang-DNA herausragt (sticky ends) - Methode relativ einfach, jedoch ungenau Abschnitte Erkennungsregion des Restriktionsenzyms 5GCCGATC GAATTC ATGGCTTTACGGAGTAGC GAATTC TAAAGGC3 3'CGGCTAGCTTAAG TACCGAAATGCCTCATCG CTTAAG ATTTCCGS 1 Schneidestelle des Restriktionsenzyms 5'GCCGATCG3¹ 3'CGGCTAGCTTAA5 Behandlung mit Restriktionsenzym SAATT.CATGGCTTTACGGAGTAGC G3 SAATTCTAAAGGC3 geschnittene 3'GTACCGAAATGCCTCATCG CTTAA GATTTCCG5 Ziel-DNA SAATTC GCCATGCCAAATCGCTTTAATACG³¹ 3GCGGTACGGTTTAGCGAAATTATGCTTAA Ziel-DNA Verbindung der Ziel-DNA mit dem fremden DNA-Stück durch Basenpaarung (H-Brücken) feste Verbindung mithilfe von DNA-Ligase (kovalente Bindung) 1/11 geschnittene Fremd-DNA 5'GCCGATC GAATTCGCCATGCCAAATCGCTTTAATAC GAATTC TAAAGGC3¹ 3'CGGCTAGCTTAAG CGGTACGGTTTAGCGAAATTATGCTTAAG ATTTCCG 5¹ 5'GCCGATCGAATTC GCCATGCCAAATCGCTTTAATAC GAATTC TAAAGGC3' 3'CGGCTAGCTTAAG CGGTACGGTTTAGCGAAATTATGCTTAAG ATTTCCG 5¹ Biologie Abitur Angewandte Genetik und Reproduktionsbiologie Umkopieren eines Gens von mRNA in DNA: Ein Gen lässt sich auch durch Umkopieren der entsprechenden mRNA herstellen - Das...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

entsprechende Gen wird in der Zelle durch Transkription von DNA auf mRNA umgeschrieben - Reverse Transkriptase wird aus Retroviren gewonnen, Transkription läuft damit umgekehrt 1. mRNA wird aus dem entsprechenden Zellen isoliert 2. Nach Zugabe von DNA-Nukleotiden wird mit Hilfe der reversen Transkriptase komplementär zur mRNA ein DNA Einzelstrang synthetisiert 3. Die mRNA wird von dem DNA-Einzelstrang getrennt 4. Die zugegebenen DNA-Nukleotide ergänzen den DNA-Einzelstrang komplementär zum Doppelstrang. (DNA-Polymerase erforderlich) → cDNA entsteht (copy-DNA) - In Zellen läuft nicht nur die Transkriptions eines Gens, sondern aller aktiven Gene Es entsteht ein cDNA Stück mit verschiedenen genetischen Informationen aller aktiven Gene Richtige DNA Stück muss mit einem gesonderten Vorgang herausgesucht werden In-vitro-Synthese eines Gens: Ein Gen lässt sich sehr gezielt gewinnen, indem man es chemisch in vitro, also im Labor im Reagenzglas, durch die Verkettung der entsprechenden Nukleotide in der richtigen Reihenfolge synthetisiert 1. Die Abfolge der Aminosäuren des gewünschten Genprodukts (Protein) wird festgestellt (Aminosäurefrequenz-Analyse) 2. Im Code-Lexikon wird abgelesen, welche Basensequenz der DNA die Information für die Aminosäurefrequenz des Genprodukts speichern kann 3. Aus DNA-Nukleotiden wird im Reagenzglas der entsprechende DNA-Doppelstrang synthetisiert - Durch die Degeneration des genetischen Codes ist damit zu rechnen, dass die künstliche DNA eine andere Basenfolge hat als die Natürliche Information jedoch trotzdem identisch 1.2 Transfer eines Gens Vektoren Plasmide Hybridplasmide 2/11 Ligasen DNA-Stücke, die von Zellen leicht aufgenommen werden, meist Plasmide oder Viren Kleine ringförmige DNA-Stücke in Bakterien Mischplasmide, in denen Bakterien-DNA mit fremder DNA kombiniert ist (rekombinante DNA) Enzym, welches wie ein genetischer Kleber die DNA-Stränge zu einem Strang verbindet Biologie Abitur Angewandte Genetik und Reproduktionsbiologie Arbeitsschritte eines Gentransfers: (Übertragung eines Gens auf Bakterienzelle mithilfe von Plasmiden) 1. Öffnung von Plasmidringen im Reagenzglas mit den gleichen Restriktionsenzymen, die auch zur Isollierugúng des Gens dienten, das übertragen werden soll (gleiche sticky ends) 2. Mischung der isolierten Gene mit den geöffneten Plasmid-Ringen, wenn sich komplementäre sticky-ends finden bilden sich zwei Arten von Plasmid Ringen: Art enthält nur Bakterien-DNA (Plasmidringe schließen sich an der Öffnungsstelle wieder) Art enthält zusätzlich ein fremdes DNA-Stück. Es entstehen Hybridplasmide 3. Zugabe von DNA-Ligase (DNA-Stücke verbinden sich fest miteinander) 4. Mischung der Plasmide mit und ohne Fremdgen mit Bakterienzelle, die kein Plasmid enthalten 5. Behandlung der Plasmide mit Substanz, die ihre Wand für Plasmide leicht passierbar machen Einige wenige Bakterienzellen nehmen Plasmide in Zytoplasma auf 1.3 Suche nach Bakterienzellen mit Hybridplasmiden Anschließend an die Genübertragung werden in einem nächsten Suchschritt alle Zellen aussortiert, die ein Hybridplasmid und damit fremde DNA-Stücke aufgenommen haben Voraussetzung für die Selektion: - Verwendung von Plasmiden mit zwei Resistenzgenen gegen Antibiotika, z.B. Ampicillin und Tetracyclin - Erkennungsregion des verwendeten Restriktionsenzyms muss innerhalb des Tetracyclin-Resistenz-Gens liegen - Wenn Plasmid fremde DNA aufnimmt, bleiben Bereiche des Tetracyclin-Resistenz-Gens getrennt und dadurch unwirksam (Zelle verliert Resistenz gegen Tetracyclin) Gen, das übertragen werden soll A B Schnittstellen für Restriktionsenzym Schneiden der isolierten Fremd-DNA (z. B. des Menschen) mit dem gleichen Restriktionsenzym, wie es beim Öffnen der Plasmide verwendet wird unterschiedliche DNA-Stücke (Fremd-DNA) Übertragen der Plas- mide in plasmidfreie Bakterienzellen Ampicillin- Resistenz-Gen Schneiden der isolierten Plasmide mit dem gleichen Restriktionsenzym, wie es beim Schneiden der Fremd-DNA verwendet wird Mischen der fremden DNA-Stücke mit den geöffneten Plasmiden; Aufnahme fremder DNA-Stücke oder Schließen der Plasmide ohne Einbau von Fremd-DNA ОС A Tetracyclin- Resistenz-Gen с geöffnete Plasmide B Bakterienzellen Bakterienzellen Bakterienzellen Bakterienzellen ohne Plasmid mit Plasmiden mit Hybrid- mit Hybrid- aus reiner plasmid plasmid (einge- Bakterien-DNA baute fremde (kein Hybrid- DNA besteht plasmid) aus gewünsch- tem Gen) (Übertragung eines Plasmids nicht gelungen) C Bakterienzellen mit Hybrid- plasmid 3/11 Biologie Abitur Selektion von Zellen mit Hybridplasmid: (Stempeltechnik) 1. Bakterienzellen vermehren sich in einer Nährlösung mit Ampicillin und werden auf Nährboden gebracht, der Ampicillin enthält Nur Bakterien mit einem aufgenommenen Plasmid vermehren sich 2. Übrig gebliebene Bakterien werden mit sterilem Samtstempel auf eine Kulturschale mit Tetracyclin übertragen Kolonien können im gleichen Muster wie in der Ampicillin Schale wachsen 3. In Tetracyclin-Schale vermehren sich nur solche Bakterien, welche das Tetracyclin-Resistenzgen immer noch besitzen (also kein Plasmid mit fremder DNA aufgenommen haben) → Lücken im Kolonie Muster der Tetracyclin Schale geben Kolonien an, die aus Bakterien mit der fremden DNA bestehen Bakterien aus diesen Kolonien werden in einem frischem Nährmedium vermehrt und für die weitere Arbeit verwendet Bakterienzellen ohne Plasmid (Übertragung eines Plasmids nicht gelungen) Bakterienzellen mit Plasmiden reiner Bakterien- DNA (kein Hybridplasmid) nur Vermehrung plasmidhaltiger Bakterien möglich plasmidhaltige Bakterien Nährlösung mit Ampicillin Nährboden- mit Ampicillin Angewandte Genetik und Reproduktionsbiologie Bakterienzellen mit Hybrid- plasmid Bakterienzellen mit Hybridplasmid (eingebaute fremde DNA besteht aus gewünschtem Gen) Nährboden- mit Tetracyclin Übertragen der Bakterien mit einem Samtstempel Bakterien- zellen mit Hybrid- plasmid Identifizierung der Bakterien in den Kolonien 4 und 8 als diejenigen, die ein Hybridplasmid enthalten Vermehrung der Bakterien aus den Kolonien 4 und 8 (Genbank, enthält Bakterien mit Hybridplasmiden des Typs A, B und C) Genbanken: Nach vielfacher identischer Vermehrung (Klonierung) liegen in den Bakterienkulturen zahlreiche Kopien der mit den Plasmiden in die Bakterienzelle eingeschleusten fremden DNA-Stücke vor → Solche Bakterienkulturen bezeichnet man als Genbanken 4/11 Jeden Genbank besteht aus mehreren verschiedenen Klonen von Bakterienzellen, die Plasmide mit jeweils einer anderen Fremd-DNA enthalten Um herauszufinden, welche Bakterien einer Genbank das erwünschte fremde Gen tragen, ist ein weiterer Suchvorgang erforderlich Screening: Gensonden Radioaktiv markierte einsträngige DNA-Stücke, deren Basensequenz komplementär zu der des gesuchten Gens oder eines Teils davon ist - Suche nach Bakterienzellen mit Hybridplasmiden, die das gewünschte Fremdgen enthalten, mit Hilfe von Gensonden - Zuweilen auch Einsatz von fluoreszierende Gensonden 1. Übertragung des Kolonie Musters einer Kulturschale auf spezielle Folie 2. Behandlung der Folie, um Bakterienzellen aufzubrechen, die DNA zu isolieren und durch Erhitzen einsträngig zu machen 3. Zugabe der Gensonde zur vorbehandelten Folie 4. Auswaschen der Gensonde (Gensonden, die sich durch H-Brücken an Fremdgen gebunden haben, lassen sich nicht mehr auswaschen) 5. Auflegen der Folie auf einen Röntgenfilm. An den Stellen, an denen sich die Gensonde angelagert hat, schwärzt sich der Film durch die radioaktive Strahlung (Autoradiographie) 6. Vergleich mit Kolonien Muster der Kulturschale Biologie Abitur Die Kolonien, die aus den Bakterien mit dem Plasmid mit dem gewünschten Gen entstehen werden ausgesucht und in einem frischem Nährmedium weiter vermehrt Bakterienzellen mit Hybridplasmid Bakterienzellen mit Hybridplasmid (eingebaute fremde DNA besteht aus gewünschtem Gen) Bakterienzellen mit Hybridplasmid (LEKPINK) SE Zugabe der passenden [email protected] Gensonde Kulturschale mit Bakterien der Genbank 4 19 Bindung der DNA-Sonde im Bereich des gesuchten Gens Auflegen einer Folie Angewandte Genetik und Reproduktionsbiologie Auflegen eines Röntgenfilms auf die Folie (Autoradiografie) 1 Folie mit anhaftenden Bakterien 3 6 5 7 Röntgenfilm nach der Entwicklung Isolierung der DNA und Auf- trennen in Ein- zelstränge Identifizierung der Kolonien der Kulturschale, deren Bakterien das gesuchte Gen enthalten Nach einem gelungenem Gentransfer sind transgene Zellen hergestellt - Meist liest jedoch Proteinsyntheseapparat der transgenen Zellen das Fremdgen nicht ab, das Gen wird nicht exprimiert Durch den genetischen Code zwar theoretisch möglich, jedoch mehrere Arbeitsschritte nötig um Faktoren zu aktivieren, die die Transkription steuern Beispiel: Herstellung von Insulin → Hormon welches in der Bauchspeicheldrüse produziert wird und dafür sorgt, dass die Zellen Glucose aufnehmen (bei Diabetes wird kein/zu wenig Insulin produziert) → Das früher verwendete Tier-Insulin auf Dauer nicht verträglich genug 1. Gewinnung des menschlichen Insulingens 5/11 Herstellung von cDNA aus mRNA der Insulin bildenden Zellen Anheften von sticky-ends an die cDNA Bakterien können nicht spleißen: Gen kann nicht durch Verwendung von Restriktionsenzymen gewonnen werden 2. Übertragen des Insulingens des Menschen auf Bakterienzelle Verwendung von Plasmiden mit zwei Resistenzgenen gegen Antibiotika (z. B. Ampicillin und Tetracyclin) Öffnung der Plasmide durch Restriktionsenzyme (sodass gleiche sticky-ends wie beim Anheften an die cDNA entstehen) Mischen der geöffneten Plasmidringe mit cDNA (Insulingen) Es entstehen einige Hybridplasmide (mit unwirksamen Resistenzgen gegen Tetracyclin) 3. Einschleusen der Plasmide in E. coli Bakterien 4. Isolierung von E. coli Bakterien, die ein Plasmid aufgenommen haben s. Stempeltechnik (S. 4) 5. Verfahren, bei denen die E-coli Zellen solche DNA-Stücke enthalten, die erforderlich sind, um die Transkription und Translation des Insulingens ablaufen zu lassen 6. Vermehrung der Bakterien, isolieren und reinigen von Insulin aus Bakterien → Es ist reines Humaninsulin für die Behandlung von Diabetikern entstanden

Biologie /

Gentechnik

user profile picture

Isabell  

Follow

147 Followers

 Biologie Abitur
1. Gentechnik
Gentechnik
Transgene Zellen
Genom
Angewandte Genetik und Reproduktionsbiologie
Verfahren, durch die fremde Ge

App öffnen

Lernzettel für das Biologie Abitur 2021 in Baden-Württemberg über den Themenbereich Gentechnik

Ähnliche Knows

user profile picture

3

Grundoperation der Gentechnik

Know Grundoperation der Gentechnik  thumbnail

4

 

11/12/13

user profile picture

Angewandte Genetik

Know Angewandte Genetik thumbnail

98

 

12/13

user profile picture

2

Plasmide als Vektoren/Selektion

Know Plasmide als Vektoren/Selektion thumbnail

29

 

12/13

user profile picture

3

Gentransfer und Selektion

Know Gentransfer und Selektion  thumbnail

50

 

11/12

Biologie Abitur 1. Gentechnik Gentechnik Transgene Zellen Genom Angewandte Genetik und Reproduktionsbiologie Verfahren, durch die fremde Gene in eine Zelle übertragen werden, plus die Analyse, Veränderung und die Vervielfältigung der DNA oder RNA Zellen, die ein fremdes Gen in ihrem Genom aufgenommen haben Gesamtheit aller Gene Arbeitsschritte um transgene Zellen herzustellen: 1) Gewinnung des Gens: Der betreffende DNA-Abschnitt muss isoliert oder synthetisiert werden 2) Transfer des Gens: Der DNA-Abschnitt muss durch die Zellmembran in die Zelle eingeschleust werden 3) Vervielfältigung der transgenen Zelle: Transgene Zelle mit dem darin enthaltenen Fremdgen muss vermehrt werden 4) Selektion transgener Zellen: Zellen, bei denen der Gentransfer gelungen ist, die also das Fremdgen aufgenommen haben, müssen erkannt und herausgesucht werden 1.1 Gewinnung eines Gens Isolierung eines Gens aus der DNA eines Spenderorganismus: Restriktionsenzyme Enzyme in Bakterien, welche eingedrungene virale-DNA zerschneiden und unschädlich machen Restriktionsenzyme zerlegen DNA-Moleküle wie Scheren in kleine - Restriktionsenzyme haben immer unterschiedliche Erkennungssequenzen und schneiden so, dass ein kurzes Stück Einzelstrang-DNA herausragt (sticky ends) - Methode relativ einfach, jedoch ungenau Abschnitte Erkennungsregion des Restriktionsenzyms 5GCCGATC GAATTC ATGGCTTTACGGAGTAGC GAATTC TAAAGGC3 3'CGGCTAGCTTAAG TACCGAAATGCCTCATCG CTTAAG ATTTCCGS 1 Schneidestelle des Restriktionsenzyms 5'GCCGATCG3¹ 3'CGGCTAGCTTAA5 Behandlung mit Restriktionsenzym SAATT.CATGGCTTTACGGAGTAGC G3 SAATTCTAAAGGC3 geschnittene 3'GTACCGAAATGCCTCATCG CTTAA GATTTCCG5 Ziel-DNA SAATTC GCCATGCCAAATCGCTTTAATACG³¹ 3GCGGTACGGTTTAGCGAAATTATGCTTAA Ziel-DNA Verbindung der Ziel-DNA mit dem fremden DNA-Stück durch Basenpaarung (H-Brücken) feste Verbindung mithilfe von DNA-Ligase (kovalente Bindung) 1/11 geschnittene Fremd-DNA 5'GCCGATC GAATTCGCCATGCCAAATCGCTTTAATAC GAATTC TAAAGGC3¹ 3'CGGCTAGCTTAAG CGGTACGGTTTAGCGAAATTATGCTTAAG ATTTCCG 5¹ 5'GCCGATCGAATTC GCCATGCCAAATCGCTTTAATAC GAATTC TAAAGGC3' 3'CGGCTAGCTTAAG CGGTACGGTTTAGCGAAATTATGCTTAAG ATTTCCG 5¹ Biologie Abitur Angewandte Genetik und Reproduktionsbiologie Umkopieren eines Gens von mRNA in DNA: Ein Gen lässt sich auch durch Umkopieren der entsprechenden mRNA herstellen - Das...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich einfach.

App öffnen

Alternativer Bildtext:

entsprechende Gen wird in der Zelle durch Transkription von DNA auf mRNA umgeschrieben - Reverse Transkriptase wird aus Retroviren gewonnen, Transkription läuft damit umgekehrt 1. mRNA wird aus dem entsprechenden Zellen isoliert 2. Nach Zugabe von DNA-Nukleotiden wird mit Hilfe der reversen Transkriptase komplementär zur mRNA ein DNA Einzelstrang synthetisiert 3. Die mRNA wird von dem DNA-Einzelstrang getrennt 4. Die zugegebenen DNA-Nukleotide ergänzen den DNA-Einzelstrang komplementär zum Doppelstrang. (DNA-Polymerase erforderlich) → cDNA entsteht (copy-DNA) - In Zellen läuft nicht nur die Transkriptions eines Gens, sondern aller aktiven Gene Es entsteht ein cDNA Stück mit verschiedenen genetischen Informationen aller aktiven Gene Richtige DNA Stück muss mit einem gesonderten Vorgang herausgesucht werden In-vitro-Synthese eines Gens: Ein Gen lässt sich sehr gezielt gewinnen, indem man es chemisch in vitro, also im Labor im Reagenzglas, durch die Verkettung der entsprechenden Nukleotide in der richtigen Reihenfolge synthetisiert 1. Die Abfolge der Aminosäuren des gewünschten Genprodukts (Protein) wird festgestellt (Aminosäurefrequenz-Analyse) 2. Im Code-Lexikon wird abgelesen, welche Basensequenz der DNA die Information für die Aminosäurefrequenz des Genprodukts speichern kann 3. Aus DNA-Nukleotiden wird im Reagenzglas der entsprechende DNA-Doppelstrang synthetisiert - Durch die Degeneration des genetischen Codes ist damit zu rechnen, dass die künstliche DNA eine andere Basenfolge hat als die Natürliche Information jedoch trotzdem identisch 1.2 Transfer eines Gens Vektoren Plasmide Hybridplasmide 2/11 Ligasen DNA-Stücke, die von Zellen leicht aufgenommen werden, meist Plasmide oder Viren Kleine ringförmige DNA-Stücke in Bakterien Mischplasmide, in denen Bakterien-DNA mit fremder DNA kombiniert ist (rekombinante DNA) Enzym, welches wie ein genetischer Kleber die DNA-Stränge zu einem Strang verbindet Biologie Abitur Angewandte Genetik und Reproduktionsbiologie Arbeitsschritte eines Gentransfers: (Übertragung eines Gens auf Bakterienzelle mithilfe von Plasmiden) 1. Öffnung von Plasmidringen im Reagenzglas mit den gleichen Restriktionsenzymen, die auch zur Isollierugúng des Gens dienten, das übertragen werden soll (gleiche sticky ends) 2. Mischung der isolierten Gene mit den geöffneten Plasmid-Ringen, wenn sich komplementäre sticky-ends finden bilden sich zwei Arten von Plasmid Ringen: Art enthält nur Bakterien-DNA (Plasmidringe schließen sich an der Öffnungsstelle wieder) Art enthält zusätzlich ein fremdes DNA-Stück. Es entstehen Hybridplasmide 3. Zugabe von DNA-Ligase (DNA-Stücke verbinden sich fest miteinander) 4. Mischung der Plasmide mit und ohne Fremdgen mit Bakterienzelle, die kein Plasmid enthalten 5. Behandlung der Plasmide mit Substanz, die ihre Wand für Plasmide leicht passierbar machen Einige wenige Bakterienzellen nehmen Plasmide in Zytoplasma auf 1.3 Suche nach Bakterienzellen mit Hybridplasmiden Anschließend an die Genübertragung werden in einem nächsten Suchschritt alle Zellen aussortiert, die ein Hybridplasmid und damit fremde DNA-Stücke aufgenommen haben Voraussetzung für die Selektion: - Verwendung von Plasmiden mit zwei Resistenzgenen gegen Antibiotika, z.B. Ampicillin und Tetracyclin - Erkennungsregion des verwendeten Restriktionsenzyms muss innerhalb des Tetracyclin-Resistenz-Gens liegen - Wenn Plasmid fremde DNA aufnimmt, bleiben Bereiche des Tetracyclin-Resistenz-Gens getrennt und dadurch unwirksam (Zelle verliert Resistenz gegen Tetracyclin) Gen, das übertragen werden soll A B Schnittstellen für Restriktionsenzym Schneiden der isolierten Fremd-DNA (z. B. des Menschen) mit dem gleichen Restriktionsenzym, wie es beim Öffnen der Plasmide verwendet wird unterschiedliche DNA-Stücke (Fremd-DNA) Übertragen der Plas- mide in plasmidfreie Bakterienzellen Ampicillin- Resistenz-Gen Schneiden der isolierten Plasmide mit dem gleichen Restriktionsenzym, wie es beim Schneiden der Fremd-DNA verwendet wird Mischen der fremden DNA-Stücke mit den geöffneten Plasmiden; Aufnahme fremder DNA-Stücke oder Schließen der Plasmide ohne Einbau von Fremd-DNA ОС A Tetracyclin- Resistenz-Gen с geöffnete Plasmide B Bakterienzellen Bakterienzellen Bakterienzellen Bakterienzellen ohne Plasmid mit Plasmiden mit Hybrid- mit Hybrid- aus reiner plasmid plasmid (einge- Bakterien-DNA baute fremde (kein Hybrid- DNA besteht plasmid) aus gewünsch- tem Gen) (Übertragung eines Plasmids nicht gelungen) C Bakterienzellen mit Hybrid- plasmid 3/11 Biologie Abitur Selektion von Zellen mit Hybridplasmid: (Stempeltechnik) 1. Bakterienzellen vermehren sich in einer Nährlösung mit Ampicillin und werden auf Nährboden gebracht, der Ampicillin enthält Nur Bakterien mit einem aufgenommenen Plasmid vermehren sich 2. Übrig gebliebene Bakterien werden mit sterilem Samtstempel auf eine Kulturschale mit Tetracyclin übertragen Kolonien können im gleichen Muster wie in der Ampicillin Schale wachsen 3. In Tetracyclin-Schale vermehren sich nur solche Bakterien, welche das Tetracyclin-Resistenzgen immer noch besitzen (also kein Plasmid mit fremder DNA aufgenommen haben) → Lücken im Kolonie Muster der Tetracyclin Schale geben Kolonien an, die aus Bakterien mit der fremden DNA bestehen Bakterien aus diesen Kolonien werden in einem frischem Nährmedium vermehrt und für die weitere Arbeit verwendet Bakterienzellen ohne Plasmid (Übertragung eines Plasmids nicht gelungen) Bakterienzellen mit Plasmiden reiner Bakterien- DNA (kein Hybridplasmid) nur Vermehrung plasmidhaltiger Bakterien möglich plasmidhaltige Bakterien Nährlösung mit Ampicillin Nährboden- mit Ampicillin Angewandte Genetik und Reproduktionsbiologie Bakterienzellen mit Hybrid- plasmid Bakterienzellen mit Hybridplasmid (eingebaute fremde DNA besteht aus gewünschtem Gen) Nährboden- mit Tetracyclin Übertragen der Bakterien mit einem Samtstempel Bakterien- zellen mit Hybrid- plasmid Identifizierung der Bakterien in den Kolonien 4 und 8 als diejenigen, die ein Hybridplasmid enthalten Vermehrung der Bakterien aus den Kolonien 4 und 8 (Genbank, enthält Bakterien mit Hybridplasmiden des Typs A, B und C) Genbanken: Nach vielfacher identischer Vermehrung (Klonierung) liegen in den Bakterienkulturen zahlreiche Kopien der mit den Plasmiden in die Bakterienzelle eingeschleusten fremden DNA-Stücke vor → Solche Bakterienkulturen bezeichnet man als Genbanken 4/11 Jeden Genbank besteht aus mehreren verschiedenen Klonen von Bakterienzellen, die Plasmide mit jeweils einer anderen Fremd-DNA enthalten Um herauszufinden, welche Bakterien einer Genbank das erwünschte fremde Gen tragen, ist ein weiterer Suchvorgang erforderlich Screening: Gensonden Radioaktiv markierte einsträngige DNA-Stücke, deren Basensequenz komplementär zu der des gesuchten Gens oder eines Teils davon ist - Suche nach Bakterienzellen mit Hybridplasmiden, die das gewünschte Fremdgen enthalten, mit Hilfe von Gensonden - Zuweilen auch Einsatz von fluoreszierende Gensonden 1. Übertragung des Kolonie Musters einer Kulturschale auf spezielle Folie 2. Behandlung der Folie, um Bakterienzellen aufzubrechen, die DNA zu isolieren und durch Erhitzen einsträngig zu machen 3. Zugabe der Gensonde zur vorbehandelten Folie 4. Auswaschen der Gensonde (Gensonden, die sich durch H-Brücken an Fremdgen gebunden haben, lassen sich nicht mehr auswaschen) 5. Auflegen der Folie auf einen Röntgenfilm. An den Stellen, an denen sich die Gensonde angelagert hat, schwärzt sich der Film durch die radioaktive Strahlung (Autoradiographie) 6. Vergleich mit Kolonien Muster der Kulturschale Biologie Abitur Die Kolonien, die aus den Bakterien mit dem Plasmid mit dem gewünschten Gen entstehen werden ausgesucht und in einem frischem Nährmedium weiter vermehrt Bakterienzellen mit Hybridplasmid Bakterienzellen mit Hybridplasmid (eingebaute fremde DNA besteht aus gewünschtem Gen) Bakterienzellen mit Hybridplasmid (LEKPINK) SE Zugabe der passenden [email protected] Gensonde Kulturschale mit Bakterien der Genbank 4 19 Bindung der DNA-Sonde im Bereich des gesuchten Gens Auflegen einer Folie Angewandte Genetik und Reproduktionsbiologie Auflegen eines Röntgenfilms auf die Folie (Autoradiografie) 1 Folie mit anhaftenden Bakterien 3 6 5 7 Röntgenfilm nach der Entwicklung Isolierung der DNA und Auf- trennen in Ein- zelstränge Identifizierung der Kolonien der Kulturschale, deren Bakterien das gesuchte Gen enthalten Nach einem gelungenem Gentransfer sind transgene Zellen hergestellt - Meist liest jedoch Proteinsyntheseapparat der transgenen Zellen das Fremdgen nicht ab, das Gen wird nicht exprimiert Durch den genetischen Code zwar theoretisch möglich, jedoch mehrere Arbeitsschritte nötig um Faktoren zu aktivieren, die die Transkription steuern Beispiel: Herstellung von Insulin → Hormon welches in der Bauchspeicheldrüse produziert wird und dafür sorgt, dass die Zellen Glucose aufnehmen (bei Diabetes wird kein/zu wenig Insulin produziert) → Das früher verwendete Tier-Insulin auf Dauer nicht verträglich genug 1. Gewinnung des menschlichen Insulingens 5/11 Herstellung von cDNA aus mRNA der Insulin bildenden Zellen Anheften von sticky-ends an die cDNA Bakterien können nicht spleißen: Gen kann nicht durch Verwendung von Restriktionsenzymen gewonnen werden 2. Übertragen des Insulingens des Menschen auf Bakterienzelle Verwendung von Plasmiden mit zwei Resistenzgenen gegen Antibiotika (z. B. Ampicillin und Tetracyclin) Öffnung der Plasmide durch Restriktionsenzyme (sodass gleiche sticky-ends wie beim Anheften an die cDNA entstehen) Mischen der geöffneten Plasmidringe mit cDNA (Insulingen) Es entstehen einige Hybridplasmide (mit unwirksamen Resistenzgen gegen Tetracyclin) 3. Einschleusen der Plasmide in E. coli Bakterien 4. Isolierung von E. coli Bakterien, die ein Plasmid aufgenommen haben s. Stempeltechnik (S. 4) 5. Verfahren, bei denen die E-coli Zellen solche DNA-Stücke enthalten, die erforderlich sind, um die Transkription und Translation des Insulingens ablaufen zu lassen 6. Vermehrung der Bakterien, isolieren und reinigen von Insulin aus Bakterien → Es ist reines Humaninsulin für die Behandlung von Diabetikern entstanden