Biologie /

Biologieklausur Genetik 1 | Erste Genetikklausur Biologie LK | Vererbung, Mendel | Krankheiten, Stammbäume, ß- Thalassämie | mRNA Prozessierung | Mutationen

Biologieklausur Genetik 1 | Erste Genetikklausur Biologie LK | Vererbung, Mendel | Krankheiten, Stammbäume, ß- Thalassämie | mRNA Prozessierung | Mutationen

 Bi1 - Q1 (Stz)
150 Minuten
II. Thalassämie - eine erblich bedingte Krankheit
1. Biologieklausur LK
- Genetik -
II.1 Erklären Sie, wie die K

Biologieklausur Genetik 1 | Erste Genetikklausur Biologie LK | Vererbung, Mendel | Krankheiten, Stammbäume, ß- Thalassämie | mRNA Prozessierung | Mutationen

user profile picture

evelyn🫧

16 Followers

Teilen

Speichern

83

 

11/12/10

Klausur

1. Bio LK Klausur in Genetik

Nichts passendes dabei? Erkunde andere Fachbereiche.

Bi1 - Q1 (Stz) 150 Minuten II. Thalassämie - eine erblich bedingte Krankheit 1. Biologieklausur LK - Genetik - II.1 Erklären Sie, wie die Krankheit vererbt wird und schließen Sie alternative Erbgänge aus. Ordnen Sie anschließend den Personen 1,2,3,4,8,9,10,11,13,14,18 und 24 sichere und mögliche Genotypen zu und begründen Sie ihre Entscheidung. Diskutieren Sie den Kinderwunsch von Person 24 (Material C). II.2 Erläutern Sie den Vorgang der mRNA-Prozessierung. II.3 Erklären Sie die molekularbiologischen Ursachen der ß-Thalassämie. Geben Sie dazu auch die Veränderungen in der DNA- und Aminosäuresequenz des ß-Globin-Gens an und leiten Sie auf Basis ihrer Ergebnisse die Konsequenzen für das ß-Globin ab (Material A, B und D). II.4 Stellen Sie eine begründete Hypothese zu den verschiedenen Verlaufsformen der B- Thalassämie auf. Leiten Sie zudem Gründe ab, warum auch 10 % des defekten ß-Globin- Gens korrekt translatiert wird (Material A und D). Material A: ß-Thalassämie Die ß-Thalassämie ist eine Erbkrankheit des Menschen, bei der die Bildung des Hämoglobins zu 90% gestört ist. Da der Sauerstofftransport von der Lunge zu den Geweben mit Hilfe des Hämoglobins in den Erythrozyten (Rote Blutkörperchen) erfolgt, kommt es bei dieser Krankheit zu Sauerstoffmangel in den Geweben, was sich bei leichten Verlaufsformen in Blässe, Schwindel und Konzentrationsstörungen äußern kann. Schweren Verlaufsformen gehen mit inneren Wachstumsstörungen, Schäden Organen oder dem Tod einher. an a Das Hämoglobin besteht aus zwei α- und zwei B-Ketten mit vier Hämgrup- pen, an die der Sauerstoff...

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Alternativer Bildtext:

angelagert wird. Material B: Codesonne 3' Val Arg Ser Ala COTOUCAGUCA A Lys G A C U G A U Asp Asn G Glu U G Thr A Gly Met Start Schuljahr 2021/2022 Datum: 04.11.2021 3' C PEUGACUGACUG GU Phe Leu GU 5' A C lle UG 3' Arg C SUCAGUCA A Ser A Küche C Gin 0236 Tyr G A G U U His G U Cys C C C G viel Erfolg! Stop Stop Pro A Leu Trp Stop 3' BI1 - Q1 (Stz) 150 Minuten I. Wenn ein Bulle falsch springt 1.1 Beschreiben Sie kurz die Phänotypen der Elterntiere und den des Bastards (Material A). 1. Biologieklausur LK - Genetik - 1.2 Entwickeln Sie auf Grundlage von Material A ein Kreuzungsschema für die zwei in Erscheinung tretenden Merkmale. Nehmen Sie im Zuge dessen Bezug zu den Mendelschen Regeln. Farbe & Muster bian, Schwarz 1.3 Erläutern Sie unter Berücksichtigung der Mendelschen Regeln, wie aus Belted Galloway und Telemarkrind ein Tier gezüchtet werden kann, das bei einheitlich brauner Grundfarbe einen weißen Gürtel in der Körpermitte aufweist. 1.4 Nehmen Sie zu den in Material B dargestellten Zahlenverhältnissen begründet Stellung. Beurteilen Sie im Zuge dessen die Bedeutung der 3. Mendelschen.Regel für die Züchtung. gres Phänotypen Anzahl Material A: Phänotypen Rinder Beave Material B: Phänotypen einer Rinderzuchtgeneration 63 Schuljahr 2021/2022 04.11.2020 Abb. 1: Rinderrassen. A Telemarkrind; B Belted Galloway; C Bastard-Kalb. Der Haustierpark in Warder, Schleswig-Holstein, hat sich die Zurschaustellung und Erhaltung seltener Haustierrassen zur Aufgabe gemacht. Unter anderem werden dort zwei Rinderrassen gezeigt, das braune norwegische Telemarkrind (A) und das schwarzweiße Belted Galloway (B) aus Schottland (Abb. 1). Im Sommer 1998 wurden die beiden Rassen kurzfristig gemeinsam auf einer Weide gehalten und es kam zu einer unerwünschten Paarung: Ein Belted Galloway Rind wurde vom Telemark-Bullen gedeckt. Das Bastard-Kalb (C) konnte nicht weiter für die Zucht verwendet werden, war aber aus genetischer Sicht durchaus interessant. 59 mRNA & RID 184 alle reinerbig für ihr менстае 39 aa 19 20 5' 10 B-HB AS Nr.: DNA Abschnitt: Ex1 Länge: 90 N Material C: Familienstammbaum ß-Thalassämie 1 Exon 1 Exon 1 aa 21 *** 30 Aa 99 12 Aa 22 In 1 130 N AG GU 1 Aa AAa 104 ATEIAG AT 104 Antra الله 104 13 31... 23 Ex2 222 N O 2 Aq 104 Aa Material D: Sequenzausschnitt aus der prä-mRNA des ß-Globin-Gens Hämoglobin ist ein großes Protein, das aus verschiedenen Aminosäureketten aufgebaut ist. Eine dieser Ketten ist das sogenannte ß-Globin. Es wird vom B-Globin-Gen codiert, dessen prä- mRNA aus drei Exons und zwei Introns besteht. Am Anfang und am Ende eines Introns befindet sich jeweils eine bestimmte Basensequenz, die sogenannte Anfangs- bzw. Endsequenz. Die Basenfolge AGGU ist die Anfangs- und die Basenfolge UUAG die Endsequenz. Das Spleißen kann nur dann erfolgen, wenn sich Anfangs- und Endsequenz unter Ausbildung einer schleifenartigen Struktur aneinanderlegen. Dabei wird unmittelbar vor der Anfangs- und unmittelbar nach der Endsequenz geschnitten. буладала AA/Aa 6 Aa Aa 14 15 aa 24 Kinderwunsch! Intron 1 Intron 1 In2 850 N 115 VAa A08 A4/Aa ra 16 Ex3 126 N AG GU UCUGCCUAUUGGUUUAGUCAUCCUUAGG CUGAA! BAA 105... 146 aa 17 aa 25 130 Exon 2 UCUGCCUAUUAGUUUAGUCAUCCUUAG G CUGAA! 115 18 Exon 2 AAAa 9 aa 26 3' 3' Abb 1: Der Sequenzausschnitt aus der prä-mRNA des B-Globin-Gens bei einem Gesunden (a) und einem an Thalassämie Erkrankten (b). Die Zahlen geben die Nummer der Base im Intron an. Die nicht abgebildeten Basen sind identisch. Erwartungshorizont Evelyn Vorgaben für die Bewertung von Schülerleistungen A) Inhaltliche Leistung Teilaufgabe 1 1... beschreibt kurz die Phänotypen, in etwa: Belted Galloway Rinder: schwarz gefärbt, tragen in der Körpermitte einen weißen Gürtel (eng. belt) Gameten F₁ Telemark-Rinder: rotbraune Körperfarbe, vom Kopf bis zur Schwanzwurzel verläuft auf dem Rücken ein breiter weißer Streifen, Bauch und Beine sind ebenfalls weiß Bastard: schwarze Grundfarbe seiner Mutter, weiße Musterung des Vaters: weißer Streifen auf dem Rücken, der vom Hals bis zur Schwanzwurzel verläuft, sowie weiß gefärbte Hinterbeine. 2... entwickeln ein Kreuzungsschema für die vorliegende Kreuzung und begründet, welche der MENDELschen Regeln zur Anwendung kommt, in etwa: Es handelt sich um eine Zweifaktoren-Kreuzung: 55mm Sm SsMm Sm Xo Wenn ein Bulle falsch springt Der Prüfling ... SM SSMM SsMm Bi1 LK-Q1 (STZ) SM → Farbe schwarz (S) = dominant gegenüber rotbraun (s) →Fellmusterung des Telemark Rindes (M)= dominant gegenüber dem Belted- Galloway- Muster (m) Die 1. MENDELsche Regel kommt zur Anwendung Nachkommen sind uniform 3 ... erläutern, wie aus Belted Galloway und Telemarkrind ein Tier gezüchtet werden kann, das bei einheitlich brauner Grundfarbe einen weißen Gürtel in der Körper mitte aufweist und begründet, welche der MENDELschen Regeln zur Anwendung kommt, in etwa: Unter Anwendung der 3. MENDELschen Regel, der Rekombinantenregel, ließe sich das gewünschte Tier mit einheitlich rotbrauner Körpergrundfarbe und einem weißen Gürtel um die Körpermitte züchten. Dazu müsste man zwei Individuen der F1-Generation, die wie das abgebildete Bastardkalb aussehen, miteinander kreuzen Mit einer Wahrscheinlichkeit von 1:15 (resultierend aus dem erwarteten statistischen Verhältnis von 9:3:3:1) würde dann ein Lebewesen mit beiden rezessiven Allelen im Phänotyp entstehen ... nimmt zum Zahlenverhältnis Stellung und Beurteilt die Bedeutung der 3. Regel, in etwa: 4 das tatsächliche Zahlenverhältnis entspricht der Wahrscheinlichkeit für die Verteilung der Phänotypen in der F2-Generation (9:33:1) nur in Bezug auf drei der vier Phänotypen Die Mendel'schen Regeln geben lediglich Prognosen zum statistischen Zahlenverhältnis der Nachkommen einer Kreuzung in Bezug auf den Phäno- und Genotypen möglich, theoretisches Konstrukt, trifft daher nicht immer 1:1 zu, Mit Hilfe der 3. Regel ist es möglich, Individuen mit unterschiedlichen Kombinationen an Merkmalen zu kreuzen, um eine bis dahin noch unbekannte Kombination zu erhalten → Züchtung neuer Rassen in Tier- und Pflanzenwelt, gezielte Auslese neuer Rassen oder Vermeidung bestimmter Phänotypen (z.B. Bastardkälber in der Züchtung unerwünscht) Erfüllt ein weiteres Aufgabenbezogenes Kriterium (3) Kreuzungsquadrat 1.3 Summe P max 8 12 14 P 10 12 3 46 28 28 Teilaufgabe 2 B-Thalassämie Der Prüfling... 1 ... erklärt, wie die Krankheit vererbt wird, schließt dabei andere Erbgänge begründet aus, gibt die geforderten Genotypen an und diskutiert den Kinderwunsch von Person 24, in etwa: Es handelt sich um einen autosomal-rezessiven Erbgang, da Zahlenverhältnisse gesund/krank etwa 2:1 gesunde Väter kranke Töchter haben, gonosomal-rezessive Vererbung somit nicht möglich ist (1/3) kranke Väter kranke Söhne haben, gonosomal- dominante Vererbung also ausscheidet (17/26) gesunde Eltern eine kranke Tochter haben, somit eine autosomal-dominante Vererbung ebenfalls nicht möglich ist (13/14/24) 2 3 4 *** Personen 12.4.10,13.14.18 müssen heterozygot Aa sein, da sie selbst nicht krank sind, aber kranke Kinder haben → 3,11,24 erkrankt = homozygot für das rezessive Allel (aa) Personen 8 und 9 können sowohl homozygot AA oder heterozygot Aa für das Merkmal sein, Es gilt folgende Einschränkung: mindestens einer Aa, höchstens einer AA Legende: a= rezessives Allel (defektes ß-Globin-Gen), A-dominantes Allel (gesundes ß-Globin-Gen) abhängig von dem Genotyp des Vaters (aa, Aa, AA) → Gentest zur Sicherheit da Person 24 homozygot für das defekte Allel ist, sollte der Mann nach Möglichkeit den Genotypen AA tragen gesunde Kinder, jedoch Konduktoren Mann homozygot aa = alle Kinder erkranken, Mann heterozygot Aa= Wahrscheinlichkeit von 50%, dass Kinder erkranken erläutert kurz der Vorgang der mRNA-Prozessierung, in etwa: Prozessierung bei Eukaryoten im Zellkern Transkription → zuerst prä-mRNA = enthält nicht-codierende Abschnitte (Introns) und codierende Abschnitte (Exons) am 5'-Ende der prä-mRNA wird ein verändertes Guaninnukleotid angeheftet, das als Schutz vor enzymatischem Abbau im Cytoplasma dient →cap-Struktur erleichtert zudem die Anheftung an Ribosomen 3'-Ende lange Kette von Adeninnukleotiden angefügt → Poly-A-Schwanz schützt vor enzymatischem Abbau Verbindung der Exons zu einem Enzyme schneiden die Introns aus der prä-mRNA heraus zusammenhängenden mRNA-Molekül Das Ergebnis der Prozessierung ist die reife mRNA, diese verlässt den Zellkem → Translation erklärt die Ursache der B-Thalassämie und gibt die Veränderungen auf der DNA- und AS-Ebene an: bei der an ß-Thalassämie erkrankten Person befindet sich im Intron 1 der prä-mRNA an einer Stelle die Base Adenin anstelle der Base Guanin → DNA T statt C an Stelle 114 → Die Ursache hierfür ist eine Punktmutation im ß-Globin-Gen Durch diese Punktmutation ergibt sich eine zusätzliche Endsequenz für das Intron 1 und somit ein verlängertes bzw. verändertes Exon 2, das eine andere Aminosäuresequenz codiert als bei einer gesunden Person. 5. Codon nach neuer Endsequenz = Stoppcodon UAG → Abbruch der Proteinbiosynthese Die Aminosäurekette des ß-Globins ist zu kurz, das Exon 2 und das Exon 3 wurden gar nicht abgelesen → Normal 146 AS, defekt 34 AS DNA prā mRNA AS DNA prä mRNA AS 3'TCCA... AGA-CGG-ATA-ATC-AAA-TCA-GTA-GGA-ATCI CGA-CTT...5' 5'AGGU... UCU-GCC-UAU-UAG-UUU-AGU-CAU-CCU-WAGI GCU-GAA...3 Neue Endsequenz PHE SER HIS PRO STOPPI Durch den Einbau der viel zu kurzen ß-Globinketten ist die Funktion des Hämoglobins eingeschränkt Es wird viel zu wenig intaktes Hämoglobin gebildet Somit kommt es zu Blutarmut, Sauerstoffmangel, Schwindel 3 TCCA... AGA-CGG-ATA-ACC-AAA-TCA-GTA-GGA-ATC ICGA-CTT...5' 5'AGGU... UCU-GCC-UAU-UGG-UUU-AGU-CAU-CCU-UAG I GCU-GAA...3¹ ALA GLU stellt eine begründete Hypothese auf, in etwa: Dass 10% der mRNAs richtig gespleißt werden, zeigt, dass das Spleißosom nicht ganz genau arbeitet und auch einmal mögliche Spleißstellen überspringt liegt Heterozygotie vor, kann 50 % korrektes Hämoglobin hergestellt werden, somit leichtere Symptome 2.2 Erfüllt ein weiteres Aufgabenbezogenes Kriterium (6) Summe Prouaryoten B) Darstellungsleistung Summe Darstellungsleistung Gesamtpunktzahl (Teil A + B) Die Klausur win 05. Datum führt seine Gedanken schlüssig, stringent und klar aus. strukturiert seine Darstellung sachgerecht. verwendet eine differenzierte und präzise Sprache gestaltet seine Arbeit formal ansprechend. Der Prüfling... P max 22 rtet. 12 10 P 5 12 18 O P max P 7 62 18 128 128 120 54

Biologie /

Biologieklausur Genetik 1 | Erste Genetikklausur Biologie LK | Vererbung, Mendel | Krankheiten, Stammbäume, ß- Thalassämie | mRNA Prozessierung | Mutationen

Biologieklausur Genetik 1 | Erste Genetikklausur Biologie LK | Vererbung, Mendel | Krankheiten, Stammbäume, ß- Thalassämie | mRNA Prozessierung | Mutationen

user profile picture

evelyn🫧

16 Followers
 

11/12/10

Klausur

Dieser Inhalt ist nur in der Knowunity App verfügbar.

 Bi1 - Q1 (Stz)
150 Minuten
II. Thalassämie - eine erblich bedingte Krankheit
1. Biologieklausur LK
- Genetik -
II.1 Erklären Sie, wie die K

App öffnen

1. Bio LK Klausur in Genetik

Ähnliche Knows

user profile picture

1

Spleißen Definition

Know Spleißen Definition  thumbnail

7

 

11/12/13

user profile picture

6

Proteinbiosynthese | Genetik

Know Proteinbiosynthese | Genetik thumbnail

41

 

11/12/10

user profile picture

1

Prozessierung

Know Prozessierung thumbnail

3

 

11/10

user profile picture

RNA- Prozessierung

Know RNA- Prozessierung thumbnail

26

 

11

Bi1 - Q1 (Stz) 150 Minuten II. Thalassämie - eine erblich bedingte Krankheit 1. Biologieklausur LK - Genetik - II.1 Erklären Sie, wie die Krankheit vererbt wird und schließen Sie alternative Erbgänge aus. Ordnen Sie anschließend den Personen 1,2,3,4,8,9,10,11,13,14,18 und 24 sichere und mögliche Genotypen zu und begründen Sie ihre Entscheidung. Diskutieren Sie den Kinderwunsch von Person 24 (Material C). II.2 Erläutern Sie den Vorgang der mRNA-Prozessierung. II.3 Erklären Sie die molekularbiologischen Ursachen der ß-Thalassämie. Geben Sie dazu auch die Veränderungen in der DNA- und Aminosäuresequenz des ß-Globin-Gens an und leiten Sie auf Basis ihrer Ergebnisse die Konsequenzen für das ß-Globin ab (Material A, B und D). II.4 Stellen Sie eine begründete Hypothese zu den verschiedenen Verlaufsformen der B- Thalassämie auf. Leiten Sie zudem Gründe ab, warum auch 10 % des defekten ß-Globin- Gens korrekt translatiert wird (Material A und D). Material A: ß-Thalassämie Die ß-Thalassämie ist eine Erbkrankheit des Menschen, bei der die Bildung des Hämoglobins zu 90% gestört ist. Da der Sauerstofftransport von der Lunge zu den Geweben mit Hilfe des Hämoglobins in den Erythrozyten (Rote Blutkörperchen) erfolgt, kommt es bei dieser Krankheit zu Sauerstoffmangel in den Geweben, was sich bei leichten Verlaufsformen in Blässe, Schwindel und Konzentrationsstörungen äußern kann. Schweren Verlaufsformen gehen mit inneren Wachstumsstörungen, Schäden Organen oder dem Tod einher. an a Das Hämoglobin besteht aus zwei α- und zwei B-Ketten mit vier Hämgrup- pen, an die der Sauerstoff...

Nichts passendes dabei? Erkunde andere Fachbereiche.

Mit uns zu mehr Spaß am Lernen

Hilfe bei den Hausaufgaben

Mit dem Fragen-Feature hast du die Möglichkeit, jederzeit Fragen zu stellen und Antworten von anderen Schüler:innen zu erhalten.

Gemeinsam lernen

Mit Knowunity erhältest du Lerninhalte von anderen Schüler:innen auf eine moderne und gewohnte Art und Weise, um bestmöglich zu lernen. Schüler:innen teilen ihr Wissen, tauschen sich aus und helfen sich gegenseitig.

Sicher und geprüft

Ob Zusammenfassungen, Übungen oder Lernzettel - Knowunity kuratiert alle Inhalte und schafft eine sichere Lernumgebung zu der Ihr Kind jederzeit Zugang hat.

App herunterladen

Knowunity

Schule. Endlich einfach.

App öffnen

Alternativer Bildtext:

angelagert wird. Material B: Codesonne 3' Val Arg Ser Ala COTOUCAGUCA A Lys G A C U G A U Asp Asn G Glu U G Thr A Gly Met Start Schuljahr 2021/2022 Datum: 04.11.2021 3' C PEUGACUGACUG GU Phe Leu GU 5' A C lle UG 3' Arg C SUCAGUCA A Ser A Küche C Gin 0236 Tyr G A G U U His G U Cys C C C G viel Erfolg! Stop Stop Pro A Leu Trp Stop 3' BI1 - Q1 (Stz) 150 Minuten I. Wenn ein Bulle falsch springt 1.1 Beschreiben Sie kurz die Phänotypen der Elterntiere und den des Bastards (Material A). 1. Biologieklausur LK - Genetik - 1.2 Entwickeln Sie auf Grundlage von Material A ein Kreuzungsschema für die zwei in Erscheinung tretenden Merkmale. Nehmen Sie im Zuge dessen Bezug zu den Mendelschen Regeln. Farbe & Muster bian, Schwarz 1.3 Erläutern Sie unter Berücksichtigung der Mendelschen Regeln, wie aus Belted Galloway und Telemarkrind ein Tier gezüchtet werden kann, das bei einheitlich brauner Grundfarbe einen weißen Gürtel in der Körpermitte aufweist. 1.4 Nehmen Sie zu den in Material B dargestellten Zahlenverhältnissen begründet Stellung. Beurteilen Sie im Zuge dessen die Bedeutung der 3. Mendelschen.Regel für die Züchtung. gres Phänotypen Anzahl Material A: Phänotypen Rinder Beave Material B: Phänotypen einer Rinderzuchtgeneration 63 Schuljahr 2021/2022 04.11.2020 Abb. 1: Rinderrassen. A Telemarkrind; B Belted Galloway; C Bastard-Kalb. Der Haustierpark in Warder, Schleswig-Holstein, hat sich die Zurschaustellung und Erhaltung seltener Haustierrassen zur Aufgabe gemacht. Unter anderem werden dort zwei Rinderrassen gezeigt, das braune norwegische Telemarkrind (A) und das schwarzweiße Belted Galloway (B) aus Schottland (Abb. 1). Im Sommer 1998 wurden die beiden Rassen kurzfristig gemeinsam auf einer Weide gehalten und es kam zu einer unerwünschten Paarung: Ein Belted Galloway Rind wurde vom Telemark-Bullen gedeckt. Das Bastard-Kalb (C) konnte nicht weiter für die Zucht verwendet werden, war aber aus genetischer Sicht durchaus interessant. 59 mRNA & RID 184 alle reinerbig für ihr менстае 39 aa 19 20 5' 10 B-HB AS Nr.: DNA Abschnitt: Ex1 Länge: 90 N Material C: Familienstammbaum ß-Thalassämie 1 Exon 1 Exon 1 aa 21 *** 30 Aa 99 12 Aa 22 In 1 130 N AG GU 1 Aa AAa 104 ATEIAG AT 104 Antra الله 104 13 31... 23 Ex2 222 N O 2 Aq 104 Aa Material D: Sequenzausschnitt aus der prä-mRNA des ß-Globin-Gens Hämoglobin ist ein großes Protein, das aus verschiedenen Aminosäureketten aufgebaut ist. Eine dieser Ketten ist das sogenannte ß-Globin. Es wird vom B-Globin-Gen codiert, dessen prä- mRNA aus drei Exons und zwei Introns besteht. Am Anfang und am Ende eines Introns befindet sich jeweils eine bestimmte Basensequenz, die sogenannte Anfangs- bzw. Endsequenz. Die Basenfolge AGGU ist die Anfangs- und die Basenfolge UUAG die Endsequenz. Das Spleißen kann nur dann erfolgen, wenn sich Anfangs- und Endsequenz unter Ausbildung einer schleifenartigen Struktur aneinanderlegen. Dabei wird unmittelbar vor der Anfangs- und unmittelbar nach der Endsequenz geschnitten. буладала AA/Aa 6 Aa Aa 14 15 aa 24 Kinderwunsch! Intron 1 Intron 1 In2 850 N 115 VAa A08 A4/Aa ra 16 Ex3 126 N AG GU UCUGCCUAUUGGUUUAGUCAUCCUUAGG CUGAA! BAA 105... 146 aa 17 aa 25 130 Exon 2 UCUGCCUAUUAGUUUAGUCAUCCUUAG G CUGAA! 115 18 Exon 2 AAAa 9 aa 26 3' 3' Abb 1: Der Sequenzausschnitt aus der prä-mRNA des B-Globin-Gens bei einem Gesunden (a) und einem an Thalassämie Erkrankten (b). Die Zahlen geben die Nummer der Base im Intron an. Die nicht abgebildeten Basen sind identisch. Erwartungshorizont Evelyn Vorgaben für die Bewertung von Schülerleistungen A) Inhaltliche Leistung Teilaufgabe 1 1... beschreibt kurz die Phänotypen, in etwa: Belted Galloway Rinder: schwarz gefärbt, tragen in der Körpermitte einen weißen Gürtel (eng. belt) Gameten F₁ Telemark-Rinder: rotbraune Körperfarbe, vom Kopf bis zur Schwanzwurzel verläuft auf dem Rücken ein breiter weißer Streifen, Bauch und Beine sind ebenfalls weiß Bastard: schwarze Grundfarbe seiner Mutter, weiße Musterung des Vaters: weißer Streifen auf dem Rücken, der vom Hals bis zur Schwanzwurzel verläuft, sowie weiß gefärbte Hinterbeine. 2... entwickeln ein Kreuzungsschema für die vorliegende Kreuzung und begründet, welche der MENDELschen Regeln zur Anwendung kommt, in etwa: Es handelt sich um eine Zweifaktoren-Kreuzung: 55mm Sm SsMm Sm Xo Wenn ein Bulle falsch springt Der Prüfling ... SM SSMM SsMm Bi1 LK-Q1 (STZ) SM → Farbe schwarz (S) = dominant gegenüber rotbraun (s) →Fellmusterung des Telemark Rindes (M)= dominant gegenüber dem Belted- Galloway- Muster (m) Die 1. MENDELsche Regel kommt zur Anwendung Nachkommen sind uniform 3 ... erläutern, wie aus Belted Galloway und Telemarkrind ein Tier gezüchtet werden kann, das bei einheitlich brauner Grundfarbe einen weißen Gürtel in der Körper mitte aufweist und begründet, welche der MENDELschen Regeln zur Anwendung kommt, in etwa: Unter Anwendung der 3. MENDELschen Regel, der Rekombinantenregel, ließe sich das gewünschte Tier mit einheitlich rotbrauner Körpergrundfarbe und einem weißen Gürtel um die Körpermitte züchten. Dazu müsste man zwei Individuen der F1-Generation, die wie das abgebildete Bastardkalb aussehen, miteinander kreuzen Mit einer Wahrscheinlichkeit von 1:15 (resultierend aus dem erwarteten statistischen Verhältnis von 9:3:3:1) würde dann ein Lebewesen mit beiden rezessiven Allelen im Phänotyp entstehen ... nimmt zum Zahlenverhältnis Stellung und Beurteilt die Bedeutung der 3. Regel, in etwa: 4 das tatsächliche Zahlenverhältnis entspricht der Wahrscheinlichkeit für die Verteilung der Phänotypen in der F2-Generation (9:33:1) nur in Bezug auf drei der vier Phänotypen Die Mendel'schen Regeln geben lediglich Prognosen zum statistischen Zahlenverhältnis der Nachkommen einer Kreuzung in Bezug auf den Phäno- und Genotypen möglich, theoretisches Konstrukt, trifft daher nicht immer 1:1 zu, Mit Hilfe der 3. Regel ist es möglich, Individuen mit unterschiedlichen Kombinationen an Merkmalen zu kreuzen, um eine bis dahin noch unbekannte Kombination zu erhalten → Züchtung neuer Rassen in Tier- und Pflanzenwelt, gezielte Auslese neuer Rassen oder Vermeidung bestimmter Phänotypen (z.B. Bastardkälber in der Züchtung unerwünscht) Erfüllt ein weiteres Aufgabenbezogenes Kriterium (3) Kreuzungsquadrat 1.3 Summe P max 8 12 14 P 10 12 3 46 28 28 Teilaufgabe 2 B-Thalassämie Der Prüfling... 1 ... erklärt, wie die Krankheit vererbt wird, schließt dabei andere Erbgänge begründet aus, gibt die geforderten Genotypen an und diskutiert den Kinderwunsch von Person 24, in etwa: Es handelt sich um einen autosomal-rezessiven Erbgang, da Zahlenverhältnisse gesund/krank etwa 2:1 gesunde Väter kranke Töchter haben, gonosomal-rezessive Vererbung somit nicht möglich ist (1/3) kranke Väter kranke Söhne haben, gonosomal- dominante Vererbung also ausscheidet (17/26) gesunde Eltern eine kranke Tochter haben, somit eine autosomal-dominante Vererbung ebenfalls nicht möglich ist (13/14/24) 2 3 4 *** Personen 12.4.10,13.14.18 müssen heterozygot Aa sein, da sie selbst nicht krank sind, aber kranke Kinder haben → 3,11,24 erkrankt = homozygot für das rezessive Allel (aa) Personen 8 und 9 können sowohl homozygot AA oder heterozygot Aa für das Merkmal sein, Es gilt folgende Einschränkung: mindestens einer Aa, höchstens einer AA Legende: a= rezessives Allel (defektes ß-Globin-Gen), A-dominantes Allel (gesundes ß-Globin-Gen) abhängig von dem Genotyp des Vaters (aa, Aa, AA) → Gentest zur Sicherheit da Person 24 homozygot für das defekte Allel ist, sollte der Mann nach Möglichkeit den Genotypen AA tragen gesunde Kinder, jedoch Konduktoren Mann homozygot aa = alle Kinder erkranken, Mann heterozygot Aa= Wahrscheinlichkeit von 50%, dass Kinder erkranken erläutert kurz der Vorgang der mRNA-Prozessierung, in etwa: Prozessierung bei Eukaryoten im Zellkern Transkription → zuerst prä-mRNA = enthält nicht-codierende Abschnitte (Introns) und codierende Abschnitte (Exons) am 5'-Ende der prä-mRNA wird ein verändertes Guaninnukleotid angeheftet, das als Schutz vor enzymatischem Abbau im Cytoplasma dient →cap-Struktur erleichtert zudem die Anheftung an Ribosomen 3'-Ende lange Kette von Adeninnukleotiden angefügt → Poly-A-Schwanz schützt vor enzymatischem Abbau Verbindung der Exons zu einem Enzyme schneiden die Introns aus der prä-mRNA heraus zusammenhängenden mRNA-Molekül Das Ergebnis der Prozessierung ist die reife mRNA, diese verlässt den Zellkem → Translation erklärt die Ursache der B-Thalassämie und gibt die Veränderungen auf der DNA- und AS-Ebene an: bei der an ß-Thalassämie erkrankten Person befindet sich im Intron 1 der prä-mRNA an einer Stelle die Base Adenin anstelle der Base Guanin → DNA T statt C an Stelle 114 → Die Ursache hierfür ist eine Punktmutation im ß-Globin-Gen Durch diese Punktmutation ergibt sich eine zusätzliche Endsequenz für das Intron 1 und somit ein verlängertes bzw. verändertes Exon 2, das eine andere Aminosäuresequenz codiert als bei einer gesunden Person. 5. Codon nach neuer Endsequenz = Stoppcodon UAG → Abbruch der Proteinbiosynthese Die Aminosäurekette des ß-Globins ist zu kurz, das Exon 2 und das Exon 3 wurden gar nicht abgelesen → Normal 146 AS, defekt 34 AS DNA prā mRNA AS DNA prä mRNA AS 3'TCCA... AGA-CGG-ATA-ATC-AAA-TCA-GTA-GGA-ATCI CGA-CTT...5' 5'AGGU... UCU-GCC-UAU-UAG-UUU-AGU-CAU-CCU-WAGI GCU-GAA...3 Neue Endsequenz PHE SER HIS PRO STOPPI Durch den Einbau der viel zu kurzen ß-Globinketten ist die Funktion des Hämoglobins eingeschränkt Es wird viel zu wenig intaktes Hämoglobin gebildet Somit kommt es zu Blutarmut, Sauerstoffmangel, Schwindel 3 TCCA... AGA-CGG-ATA-ACC-AAA-TCA-GTA-GGA-ATC ICGA-CTT...5' 5'AGGU... UCU-GCC-UAU-UGG-UUU-AGU-CAU-CCU-UAG I GCU-GAA...3¹ ALA GLU stellt eine begründete Hypothese auf, in etwa: Dass 10% der mRNAs richtig gespleißt werden, zeigt, dass das Spleißosom nicht ganz genau arbeitet und auch einmal mögliche Spleißstellen überspringt liegt Heterozygotie vor, kann 50 % korrektes Hämoglobin hergestellt werden, somit leichtere Symptome 2.2 Erfüllt ein weiteres Aufgabenbezogenes Kriterium (6) Summe Prouaryoten B) Darstellungsleistung Summe Darstellungsleistung Gesamtpunktzahl (Teil A + B) Die Klausur win 05. Datum führt seine Gedanken schlüssig, stringent und klar aus. strukturiert seine Darstellung sachgerecht. verwendet eine differenzierte und präzise Sprache gestaltet seine Arbeit formal ansprechend. Der Prüfling... P max 22 rtet. 12 10 P 5 12 18 O P max P 7 62 18 128 128 120 54